Are the COVID-19 Test Kits Designed to Produce False Positives (Plandemic)?

gl69m

Member
Want to recreate the original thread, posted well over a year ago (started in April 2020 by the original forum member Cabaltimes), and this will take a little while to get all the original posts in, and I plan on continually adding to the thread of course but all in due time lol!

Post #1 (original thread, from Cabaltimes)
ABSTRACT: A popular “Christian” Swedish Youtuber who goes by the moniker Zakleo Se Bumbar posted a gamechanging video on his channel four days ago. Titled “How to Create a Plandemic,” he does not dispute the existence of the COVID-19 Coronavirus or its supposed lethality. Instead he produces a convincing theory that the so-called “tests” rushed in by the WHO and the CDC/FDA can produce up to 50% false positives, setting in motion a “Plandemic.” The doubts he has raised are supported by scientific and medical data. In this post, we produce a complete transcript of his video for the first time ever. We also critically review this theory in the end. More: http://www.cabaltimes.com/2020/03/29/plandemic/

Post #2 (original thread, from Dude 111)
No doubt about it my friend!!!!!!

This is all to condition people and get them scared enough to blindly accept the enslaving vaccine coming up........

Post #3 (original thread, from gl69m)
Quote:


Originally Posted by Dude111 View Post

No doubt about it my friend!!!!!!

This is all to condition people and get them scared enough to blindly accept the enslaving vaccine coming up........
That is one purpose, I would agree.

Post #4 (original thread, from gl69m)
Summary of built in biases (that strongly favor a “positive' result outcome{which is most likely to be an actual “false positive” IMO} for 2019-nCoV) within this protocol:

DC-006-00019, Revision: 03 CDC/DDID/NCIRD/ Division of Viral Diseases Effective: 3/30/2020CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use OnlyInstructions for UseCatalog # 2019-nCoVEUA-01 1000 reactionsFor In-vitro Diagnostic (IVD) UseRx Only
https://www.fda.gov/media/134922/download


I have done an analysis of biases in the above document, and have a couple of brief comparisons of bias in the 2019-nCoV protocol as compared to these two Influenza protocols below:

CDC Human Influenza Virus Real-TimeRT-PCR Diagnostic Panel(CDC Flu rRT-PCR Dx Panel)
Influenza A/B Typing Kit
https://journals.plos.org/plosone/ar...e.0201248.s007
FluIVD03-1

CDC protocol of realtime RTPCR for influenza A(H1N1) 28 April 2009 revision 1 (30 April 2009) revision 2 (6 October 2009)
The WHO Collaborating Centre for influenza at CDC Atlanta, United States of America, has made available the protocol, attached, of realtime RTPCR for influenza A(H1N1).
https://www.who.int/csr/resources/pu...9_20090430.pdf


This post is a condensed summary of the longer analysis, I am posting that one after this post for easier reference for everyone (your welcome
biggrin.gif
), well hopefully my effort on this is worth something to somebody out there). The detailed analysis post is hella long, warning everybody now (
icon_twisted.gif
).


Bias summary-


1- Disease cause “disclaimer” (I call it one but I'm sure CDC wouldn't, from page 2 in protocol), a “positive” result for 2019-nCoV in this test, does not rule out co-infection (other viruses and bacteria) or determine definitive disease cause.

2- A “negative” result in this test will not rule out infection of 2019-nCoV (page 2 in protocol).

3- Can only use this test under FDA emergency authorization (page 2 protocol), test method was not validated (rigorously) through normal means, method was “fast-tracked”. We don't know how reliable the method is, probably never will. In my estimation, this fast-tracked method is not proof at all that 2019-nCoV is a real virus, particularly when a “live exercise” is still ongoing and was before this test method came out.

4- “RNA isolated and purified from upper and lower respiratory specimens” in my opinion is a misleading statement (from page 3 in protocol) to bias the technician into thinking/believing there is likely to be viral RNA in the specimen (RNA from '2019-nCoV' of course).

5- Materials provided from only “qualified” suppliers (from page 5 in protocol): this is probably an unavoidable bias in any of these kinds of tests, but none the less a risk of purposeful contamination of '2019-nCoV' RNA (remember, any designer DNA/RNA sequence can be printed artificially these days, I have yet to post on that but I will) within any of the reagents from the “qualified” suppliers will always still exist. Why? Because we can never rule out that there may be intelligence agents (who are in on the live Covid-19 exercise) working at any of these testing labs or the reagent suppliers.

6- As the most abundant protein in CoVs, nucleocapsid (N) protein is highly conserved across CoVs [91]. (from this article here https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7077191/). This means the N1 and N2 primers that target regions in the N gene may actually hybridize and amplify N gene from other coronaviruses if they are present in a clinical specimen, producing a false positive, I really do believe that could occur in probably a significant % of the time (significant number of tests). I could be wrong I guess, maybe.

7- Possible bias, labs can substitute their own non-standard HSC (Human Specimen Control, page 6 in protocol), and introduce possible contamination in the whole testing areas and protocol. Possibly, I don't know for sure.

8- RNA (human and or viral) extraction efficiency was not validated with '2019-nCoV' in this method, but was for Influenza (for the Extraction Platforms {commercial test kits}, page 8 in protocol), so therefore simply assumed it will work for '2019-nCoV'.

9- On page 9 Warnings and Precautions, onto page 10, specimen or the real-time reagents used in theamplification step can become contaminated by accidental introduction of amplification product (amplicon). This can be a typical lab error and is not always easily controlled with so many steps in the procedure and difficult to avoid completely or trace every time it occurs. Error is not an automatic bias towards “false positives” but in “a live exercise” and rushed high volume lab testing I have no doubt it can become a significant bias.

10- 10- Possible bias

On page 12 it refers to shipping all samples to the CDC recipient, we do not know the state of or the rigorousness of the chain of custody documentation with specimens being shipped for 'Covid-19' testing.

11- Possible bias, HSC may be excluded at testing lab's discretion?

On page 13 it says that the HSC (Human Specimen Control) is not provided, but that the HSC “must be extracted and processed with each specimen extraction run.”, however page 18 states that the user can replace sample 10 (specimen sample, S10, in the row 11 wells) with HSC, “if necessary”. If HSC can be excluded this is an important performance assay control biasing against full RNA extraction (RP in particular) and favors a “positive” if '2019-nCoV' markers show up. If I find out HSC cannot be excluded from this protocol I will remove this bias from the list at a later point.

12- From page 15, CDC covering it's ass if labs/suppliers are discovered to have testing problems,

Disclaimer: Names of vendors or manufacturers are provided as examples of suitable product sources. Inclusion does not imply endorsement by the Centers for Disease Control and Prevention.

13- Instrument bias: present in any machine testing, errors or user bias (unintentional or intentional), most notable possible user intentional bias, “adjustment of the threshold” (signal) value, and the number cycles of thermal cycling chosen (or each thermal cycle individual parameters) (see figure 18 on page 32 of protocol).

14- Interpretation of Results and Reporting (the doozy, pages 33-36), if RNA extraction control (RP) fails (indicating possibly no RNA of any kind to begin with) but '2019-nCoV' markers still show up, call the sample good (“positive”) on first try, but “invalid” (don't call it “negative”) if they don't show up. Clear bias towards positive results and “fattening the curve”. This interpretation (also present in the 2014 Influenza protocol) seems to be absent from the 2009 Influenza protocol.

15- Multiple specimens at different times needed to “detect” virus, this may be true for other (real) viruses, but the “optimal” time for 2019-nCoV has not been determined (see “b” under the table, from page 35).

16- Have to consult State Health Lab or CDC for inconclusive results (from page 35).

17- no quantified virus isolates of the 2019-nCoV are currently available (page 38 ),assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA. Is this a possible admission the virus is fake and that the '2019-nCoV' genome may be a mock (theoretical genome)? Well, I think it's possible: my tinfoil hat dunning-kreuger senses (not spidy senses
biggrin.gif
) are tingling, how about yours?


This is the list for now, may add to it or take away if necessary later.
 

gl69m

Member
Post #5 (original thread, from gl69m), I'm not going through the trouble of fixing all issues with the links that arise from copying from the Way Back Machine web archive site, might dig up links in future posts if need be.
First off thanks to Cabal (not the bad kind
biggrin.gif
that is!) for starting this thread, very important right now. I have said on the other thread (Coronavirus ) that I wanted to do a post detailing the built in bias of the PCR based test protocol approved by the CDC, so I think it fitting to put it here instead of the other thread, since that one is getting lengthy and is more relevant in a separate thread at this time.

Second off, I apologize in advance for the length of this post
biggrin.gif
. Refer to the brief summary post if this one is too long or confusing.


Pretty good video by Zakleo Se Bumbar, he does a decent job of relaying certain problems of false positives that are known about in PCR based diagnostic testing. I see that this is Part 1, I'll have to look for Part II if he has one out yet. I've only watched it once so far, just embedding it for reference from the OP for now, may touch on it later.
Creating a Plandemic Part 1


You Tube


Not sure how much Zakleo knows about PCR or what his educational/professional background is, I have stated what mine is in multiple posts at LRF, not claiming to be any real expert of course, but I did have some limited experience, being taught and doing some PCR in the 11 month biotechnology program I had at St. Louis Community College at Florrisant Valley (2002-2003); I also performed a small amount of PCR testing when I worked at CET.


For the purposes of this post, my main point when I think of a false positive in a PCR reaction run: is that the probe or primer used (short nucleotide piece) that is supposed to be completely complimentary (or almost) to the other side of the DNA or RNA strand that it is trying to detect: ideally the primer should only bind to the most homologous binding region on the target strand of the gene your looking for only. If other DNA/RNA is present from another source (another virus or bacteria, or human say from a specimen collection), and the primer ends up binding a different gene other than the specific gene target, and DNA still gets amplified enough that the dye used (on the end of the incorporated DNA strand {reporter dye} from the reaction) as a visible marker becomes detectable by the instrument; if the amplification curve (signal intensity) looks basically the same as a positive control, than a false positive will be generated.

I may come back and explain that in more detail (only really if necessary
biggrin.gif
), but for now, the biases in this protocol I think go beyond merely that false positives could be generated as any generic PCR protocol could. I will outline them as I go through the document, I'm sure the “qualified” people would disagree; and so if any such commenter decided to post and rip my analysis apart, well they are welcome to do so, or at least try. To say there is no bias in this protocol towards a “positive” result is simply wrong the way I'm looking at it now, but if upon examination of a butt-load of other protocols showed that this a normal protocol for this kind of usage, then I would maybe have to reassess my opinion. Right now I will examine this one and compare it to a protocols from the CDC for Influenza from 2009 and 2014, to see what the differences in interpretation are for these three protocols.


Brief explanation of setup and procedure for the protocol/test:
so from page 12-16, the technician prepares each of the the primer/probe master mixes (N1 and N2 and RP) and other reagent tubes.


From page 16


Quote:

10)Set up reaction strip tubes or plates in a 96-well cooler rack.11)Dispense 15 μL of each master mix into the appropriate wells going across the row as shown below (Figure 1):
Figure 1: Example of Reaction Master Mix Plate Set-Up
159415e914413da323.png

Step 12-14, pipette in 5 ul of the NTC (no template control, should have no DNA/RNA) into wells for column 1 (figure 2).



Nucleic Acid Template Addition



Steps 1-9, vortex sample (specimens, S1 thru S9 0r S1 thru S10) tubes, briefly centrifuge tubes, place on tube rack with identical labeled setup as reaction plate (Figure 2), then pipette 5 ul of sample to sample wells columns 2-11, in order, changing tips each column etc. Add 5 ul HSC (control) "if necessary (?) to column wells 11. Cover all wells after each addition etc. Move plate to positive template control handling area.





Quote:

Assay Control Addition


1)Pipette 5 μL of nCoVPC RNA to the sample wells of column 12 (Figure 2). Securely cap wells after addition of the control RNA. NOTE:If using 8-tube strips, label the TAB of each strip to indicate sample position. DO NOT LABEL THE TOPS OF THE REACTION TUBES!
2)Briefly centrifuge reaction tube strips for 10-15 seconds. After centrifugation return to cold rack.NOTE: If using 96-well plates, centrifuge plates for 30 seconds at 500 x g, 4°C.





Quote:

159415e9144142a744.png
after addition of all these steps, proceed to instrument setup, including thermal cycling setup, pages 19-30. Run plate on programmed protocol, takes approximately 1 hour and 20 minutes before complete (including optical detection by instrument during the run), and data can then be analyzed.




Biases-


1- First of all, start off with the “disclaimer” I posted before in the Coronavirus thread, from page 2;



Quote:

Results are for the identification of 2019-nCoV RNA. The 2019-nCoV RNA is generally detectable in upper and lower respiratory specimens during infection.

Quote:

Positive results are indicative of active infection with 2019-nCoVbut do not rule out bacterial infection or co-infection with other viruses. The agent detected may not be the definite cause of disease.Laboratories within the United States and its territories are required to report all positive results to the appropriate public health authorities.
Now this is not really a bias toward a “false positive” result- as in the probes may have attached to the wrong genetic target within a human clinical specimen; but the bias is that even if this alleged virus (2019-nCoV) was present in the specimen, but yes they admit it may not be the cause of disease- however if we believe the media hype- it seems to practically be assumed that it “is the cause of disease” in a high number of patients apparently tested, and many who are not even tested as well. Like I've said already, I'm sure that the CDC will not call this a “disclaimer”.


2- The very next paragraph illuminates this bias further,


Quote:

Negative results do not preclude 2019-nCoV infection and should not be used as the sole basis for treatment or other patient management decisions. Negative results must be combined with clinical observations, patient history, and epidemiological information.
This is a bias against a “negative” result of the test ( practiced by the physicians after receiving results of “negative” from the PCR test), so as to believe it is likely to be a “false negative”- as in the test in that instance somehow may have failed to detect the virus (but it must still be in the sample of course?) and amplify the viral RNA (into cDNA in the case of this method): and this can most likely lead to what many “confirmed” cases are really actually “suspected” or “presumptive confirmed” as opposed to real so-called “positives”; because the PCR test came up negative but it is still up to the physician's diagnosis. But on top of that, as we will see later, the amount of testing to be done on each specimen and the number of specimens taken from a patient at different time points in order to generate a “positive” result(s) in these tests.


3- from page 2


Quote:

Testing with the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel is intended for use by trained laboratory personnel who are proficient in performing real-time RT-PCR assays.

Quote:

The CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel is only for use under a Food and Drug Administration’s Emergency Use Authorization.

Summary and Explanation


The term “qualified laboratories” refers to laboratories in which all users, analysts, and any person reporting results from use of this device should be trained to perform and interpret the results from this procedure by a competent instructor prior to use.
“Qualified laboratories” is also a source of bias, in the sense that, someone else trying to validate their test method, perhaps a good lab or proficient at science but not the right accreditation (perhaps like all science mostly has to have the seal of approval of the masonic/jesuit/jewish science panel); suppose just trying to independently see if they achieve a similar pos/neg result in a variety of conditions with which the test should have been validated but wasn't due to it being an “emergency” of course-only for use under a Food and Drug Administration’s Emergency Use Authorization.


4- From page 3


Quote:

Principles of the Procedure
The oligonucleotide primers and probes for detection of 2019-nCoV were selected from regions of the virus nucleocapsid (N) gene. The panel is designed for specific detection of the 2019-nCoV (two primer/probe sets). An additional primer/probe set to detect the human RNase P gene (RP) in control samples and clinical specimens is also included in the panel.
RNA isolated and purified from upper and lower respiratory specimens is reverse transcribed to cDNA and subsequently amplified
“RNA isolated and purified from upper and lower respiratory specimens”, I may get into more detail about this later, but what they are calling “ isolated and purified” RNA as in it really had to come from a virus is somewhat misleading; what really happens is a “lysis” step, where chemical reagents (possibly enzymes too) break up the cells (in this case from a human specimen) and any proteins binding to the any of the nucleic acids (RNA/DNA) in the sample and are separated enough for the molecular probe or primer to be able to find and bind to the specific gene target sequence they are supposed to be detecting.

This is not “isolation” and “purification” of a virus or it's nucleic acids as in how it is done in the gold standard way in virology, not by my understanding anyway. This would bias technicians doing this test to possibly thinking they were “isolating” or “purifying” a virus (or it's RNA or DNA) from a sample when it is not doing that at all. I'm not saying a virus cannot be detected in a clinical specimen, but the “lysis” step in and of itself is not “isolation” or “purification”.

If the “lysis” was incomplete, too much of the target template (RNA/DNA) may not have been separated from cellular debris/proteins and might not be detected (false negative), if too strong a lysis and some or too much of the target template is degraded and not detectable can also generate a false negative (I think).


5- From page 5


Quote:

Materials Required (Provided)
Note: CDC will maintain on its website a list of commercially available lots of primer and probe sets and/or positive control materials that are acceptable alternatives to the CDC primer and probe set and/or positive control included in the Diagnostic Panel. Only material distributed through the CDC International Reagent Resource and specific lots of material posted to the CDC website are acceptable for use with this assay under CDC’s Emergency Use Authorization.

This list of acceptable alternative lots of primer and probe materials and/or positive control materials will be available at:https://www.cdc.gov/coronavirus/2019...lab/index.html
This another source of bias, in that the labs you need to get the reagents and lot of supplies from, are all owned by companies assuredly connected to the big Cabal, but that has been rigged this way for the most part for probably hundreds of years, and a bias for probably any other test today, but in “a live exercise” this possible rigging should be much more suspected.

The other part of that bias is, the immense politically/scientifically correct pressure and atmosphere anyone working under the heads of these companies and govt. agencies; the technicians actually doing the test may not be trying to generate false results; but they are under intense pressure to view the protocols as valid without question, say if they perhaps would see a bias or find possible rigging of the tests, to ignore it or be dismissed (fired).

I don't imagine there are that many “whistleblowers” in the areas of this kind of biological/lab diagnostic work. There was such instances in the HIV/AIDS counter theorists camp of course. The inventor of PCR (Kary Mullis, died last year, didn't know that) is cited as another source of whistle-blowing against the accuracy of PCR to detect and pick out one gene target only (if multiple genes present) in any perfect way, however I thought I had read that he had retracted some of his earlier statements or that they had been misinterpreted, I don't recall, not worried about that now.


6- There are two specific primers (actually 3) used in this test, a forward primer, a reverse primer, and a primer at the end of the gene target length (not sure which direction{forward or reverse} it finishes off a second hybridized strand) that carries at the very end a molecular reporter dye molecule and quencher attached to reporter (I believe).

2019-nCoV_N1 Combined Primer/Probe Mix & 2019-nCoV_N2 Combined Primer/Probe Mix
“selected from regions of the virus nucleocapsid (N) gene.”

Briefly, here is an example of what the primer nucleotide sequence generally looks like:

5′-GTGARATGGTCATGTGTGGCGG-3′ (Forward), 5′-CARATGTTAAASACACTATTAGCATA-3′ (Reverse)
5′-CAGGTGGAACCTCATCAGGAGATGC-3′ (Probe in 5-FAM/3′-BHQ format),
(these three primers from link here, Identification of Coronavirus Isolated from a Patient in Korea with COVID-19, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7045880/), these primers are different and target a different gene (of reported genome of 2019-nCov) than N1 and N2 primers of the CDC protocol.

According to this paper here, the published genome of 2019-nCoV compared to SARS-CoV (2002, 03, 04);
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7077191/

From Table 2, the nucleocapsid (N) gene is about 90.52% identical in nucleotide sequence (I assume it means), it seems somewhat curious they chose a region quite well preserved in sequence between different coronavirus species.



Quote:

As the most abundant protein in CoVs, nucleocapsid (N) protein is highly conserved across CoVs [91]. The N protein in SARS-CoV-2 shares ~90% amino acid identity with that in SARS-CoV [28], which indicates that antibodies against the N protein of SARS-CoV would likely recognize and bind the N protein of SARS-CoV-2 as well.


This could also be another source of bias towards a 'positive', if in particular the primer/gene target region selected in N1 and N2 are perhaps more than 90.5% homologous (between the the different genomes): and if of course a specimen (patient) has any RNA or othe type of coronavirus (like SARS-CoV or MERS CoV, or common cold strains) in their system (could cause a “cross reaction” false positive). The original virus SARS-CoV (if a real virus) could be circulating world wide at low levels and generate some false positives on this test? I think it possible. The SARS-CoV virus is the most closely related virus (in terms of genetic identity) to that reported for the genome for 2019-nCov. I also think it would generate false positives a lot more easily on sero antibody tests too, but have to get into that later.


7- Possible bias (not sure about yet)

From page 6


Quote:

Materials Required (But Not Provided)

Quote:

Human Specimen Control (HSC)
Description
Manufactured by CDC. For use as an RNA extraction procedural control to demonstrate successful recovery of RNA as well as extraction reagent integrity. The HSC consists of noninfectious (beta-Propiolactone treated) cultured human cell material supplied as a liquid suspended in 0.01 M PBS at pH 7.2-7.4.

Acceptable alternatives to HSC:

•Negative human specimen material:Laboratories may prepare a volume of human specimen material (e.g., human sera or pooled leftover negative respiratory specimens) to extract and run alongside clinical samples as an extraction control. This material should be prepared in sufficient volume to be used across multiple runs. Material should be tested prior to use as the extraction control to ensure it generates the expected results for the HSC listed in these instructions for use.

•Contrived human specimen material: Laboratories may prepare contrived human specimen materials by suspending any human cell line (e.g., A549, Hela or 293) in PBS. This material should be prepared in sufficient volume to be used across multiple runs. Material should be tested prior to use as the extraction control to ensure it generates the expected results for the HSC listed in these instructions for use.

CDC will maintain on its website a list of commercially alternative extraction controls, if applicable, that are acceptable for use with this assay under CDC’s Emergency Use Authorization, at: https://www.cdc.gov/coronavirus/2019...lab/index.html
I wonder if these alternatives to the HSC can constitute ways in which these samples can introduce contamination (of pos control material) into the specimen test sample, accidentally or on purpose. Not sure of that, but if so could introduce bias towards positives as well.


8- from page 8


Quote:

RNA Extraction Options
For each of the kits listed below, CDC has confirmed that the external lysis buffer is effective for inactivation of SARS-CoV-2.

1Equivalence and performance of these extraction platforms for extraction of viral RNA were demonstrated with the CDC Human Influenza Virus Real-Time RT-PCR Diagnostic Panel (K190302). Performance characteristics of these extraction platforms with 2019-nCoV (SARS CoV-2) have not been demonstrated.

(and from page 14)

Equivalence and performance of the following extraction platforms were demonstrated with the CDC Human Influenza Virus Real-Time RT-PCR Diagnostic Panel (K190302) and based on those data are acceptable for use with the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel.
Performance of these extraction lysis buffers with 2019-nCoV have not been demonstrated, because the method has not been validated by the normal testing route and rigor (still do not know the length of time/testing this takes), cause it's an 'emergency' of course, fast tracked as it were. This is a clear bias in the test to “assume” that it will work with '2019-nCoV' without having to rigorously test it like normal.


9- On page 9 Warnings and Precautions, onto page 10



Quote:

Amplification technologies such as PCR are sensitive to accidental introduction of PCR product from previous amplifications reactions. Incorrect results could occur if either the clinical specimen or the real-time reagents used in the amplification step become contaminated by accidental introduction of amplification product (amplicon). Workflow in the laboratory should proceed in a unidirectional manner.

This is not an example of built in bias for this test per se, but is a source of error for PCR testing in general; if the protocol/procedure is not carefully adhered to and controlled for (technician performance errors), and sometimes cross testing studies etc needed from different labs to validate each other et all. But if the level of such errors are basically ignored (time constraints) and testing volume high (from political pressure), and politically/scientifically correct interpretation dictates “presumptive” cases should usually be positive, I submit I think this can become another source of bias for 'positive results' even without purposeful intent by technicians performing the tests, errors will likely be swept under the rug so to speak.


10- Possible bias

On page 12 it refers to shipping all samples to the CDC recipient,



Quote:

Centers for Disease Control and Prevention

Quote:

c/o STATT
Attention: Dr. Stephen Lindstrom (Unit 84)
1600 Clifton Rd., Atlanta, GA 30329-4027
Phone: (404) 639-3931
I'm not sure if samples were only shipped to CDC in the early phase of testing the protocol (the 2071 specimens tested as of Feb 22, on page 42) or still are, by this wording it does not seem to state to ship them to the other CLIA certified laboratories,



Quote:

All other laboratories that are CLIA certified and meet requirements to perform high complexity testing:
•Please notify your state and/or local public health laboratory for specimen referral and confirmatory testing guidance.
If there is no good chain of custody of samples, than perhaps at CDC or other labs, specimens could be spiked with '2019-nCoV' virus or simply the RNA and maybe proteins (if proteins are in the pos controls but not sure, and remember, DNA/RNA can now be artificially “printed” per any given sequence, have to post on that at some point), by a nefarious player wishing to boost covid-19 “confirmed positive' numbers or fattening the curve as it were. I have no idea right now if there is good chain of custody of these samples.


11- Possible bias,

On page 13 it says that the HSC (Human Specimen Control) is not provided, but that the HSC “must be extracted and processed with each specimen extraction run.”
HSC, this control is defined as- “For use as an RNA extraction procedural control to demonstrate successful recovery of RNA as well as extraction reagent integrity.”

I guess it can be obtained in other kits or use alternatives. Skipping a little ahead though, on page 18, in the protocol directions step 8 (and stated under the plate diagram {figure 2} for setup of samples), that the user can replace sample 10 (specimen sample, S10, in the row 11 wells) with HSC, “if necessary”. I would think that implies that you can exclude this control sample if deemed “unnecessary” by the testing lab?.

And so if the HSC can be excluded from the test (setup, not sure about that right now), than this would also be another bias, against checking the performance of the lysis buffer (RNA extraction from the samples/specimens), for the HSC should detect DNA (by the primer/probes for) from the human Rnase gene (RP) as well as the positive 2019-nCoV controls (has Rnase primers included with N1 & N2) should detect RP.


12- From page 15



Quote:

Manufacturer’s recommended procedures (except as noted in recommendations above) are to be followed for sample extraction. HSC must be included in each extraction batch.

Quote:


Disclaimer: Names of vendors or manufacturers are provided as examples of suitable product sources. Inclusion does not imply endorsement by the Centers for Disease Control and Prevention.
last part there is an actual noted disclaimer from the CDC, I'm guessing it means, if funny business is discovered from any lab on the list, the CDC has not “endorsed” them and so if any erroneous/false deliberate or error on the part of such lab, then CDC will claim no responsibility for that. My interpretation as it were.

13- Instrument bias (instrument setup details page 19-32); this bias could be in general any PCR protocol, the most notable bias I can think of is “adjustment of the threshold” (signal) value, and the number cycles of thermal cycling chosen. Instrument error in general could be a bias as well, perhaps favoring a negative or positive result. On the graph plot, the left (y ) variable is signal intensity of reporter dye and (the x variable is the cycle number (and really the length of time amplification has been allowed to occur).


Quote:

159415e914414852cd.png

Not going to explain any more of this part of the test/protocol right now.


Onto Interpretation of Results and Reporting (on lucky free masonic page 33 of course
biggrin.gif
)

Have to set this up first before we get to bias #14, by showing what should be (I think) any normal PCR diagnostic type test results interpretation, which is on page 33:



Quote:

Extraction and Positive Control Results and Interpretation
No Template Control (NTC)

The NTC consists of using nuclease-free water in the rRT-PCR reactions instead of RNA. The NTC reactions for all primer and probe sets should not exhibit fluorescence growth curves that cross the threshold line. If any of the NTC reactions exhibit a growth curve that crosses the cycle threshold, sample contamination may have occurred. Invalidate the run and repeat the assay with strict adherence to the guidelines.

2019-nCoV Positive Control (nCoVPC)
The nCoVPC consists of in vitro transcribed RNA. The nCoVPC will yield a positive result with the following primer and probe sets: N1, N2 and RP.

Human Specimen Control (HSC) (Extraction Control)
When HSC is run with the CDC 2019-nCoV rRT-PCR Diagnostic Panel (see previous section on Assay Set Up), the HSC is used as an RNA extraction procedural control to demonstrate successful recovery of RNA as well as extraction reagent integrity. The HSC control consists of noninfectious cultured human cell (A549) material. Purified nucleic acid from the HSC should yield a positive result with the RP primer and probe set and negative results with all 2019-nCoV markers

(and on page 34, the RP (Rnase P) control)
RNase P (Extraction Control)
All clinical samples should exhibit fluorescence growth curves in the RNase P reaction that cross the threshold line within 40.00 cycles (< 40.00 Ct), thus indicating the presence of the human RNase P gene. Failure to detect RNase P in any clinical specimens may indicate:
−Improper extraction of nucleic acid from clinical materials resulting in loss of RNA and/or RNA degradation.
−Absence of sufficient human cellular material due to poor collection or loss of specimen integrity.−Improper assay set up and execution.−Reagent or equipment malfunction.
159415e9144150f72a.png
As far as the control results interpretation, I don't have anything to quibble with there.

On page 34 though, interpretation for the RP (RNase P) control when interpreting the specimen samples however gives us a huge problem,

so here is bias #14 (the worst bias in the protocol in my estimation):


14-


Quote:

I

Quote:

f the RP assay does not produce a positive result for human clinical specimens, interpret as follows: −If the 2019-nCoV N1 and N2are positive even in the absence of a positive RP, the result should be considered valid. It is possible, that some samples may fail to exhibit RNase P growth curves due to low cell numbers in the original clinical sample. A negative RP signal does not preclude the presence of 2019-nCoV virus RNA in a clinical specimen.
This bias is carried even further as a bias against a “negative” result,



Quote:

−If all 2019-nCoV markers AND RNase P are negative for the specimen, the result should be considered invalid for the specimen.If residual specimen is available, repeat the extraction procedure and repeat the test. If all markers remain negative after re-test, report the results as invalid and a new specimen should be collected if possible.
This is basically a double whammy in these cases, if there is a problem with the RP detection. This is a control primer to insure that RNA has been successfully extracted and particularly from human cells. Extraction is necessary also to extract any viral RNA from the cells or at least separate it from cellular debris/material enough to allow amplification in the PCR thermal cycling reactions.

I don't particularly buy the “low cell number” argument here as to explain difficulty in detecting RP since it is still biased in favor of “positive” result even in the likely case of too low of viral or RNA (N1, N2 target template) extraction in the specimen (some of the viral RNA would have to be extricated from the cellular material in the extraction) samples to be detected. Biased for “positive” even if virus appears absent, but still biased towards “positive” if virus appears present but the extraction appears to be seriously compromised. Ideally I would think that the detection limit per target gene copy should be relatively equal for 3 primer sets (N1, N2, RP), perhaps they aren't; on page 44 it shows the detection limit of the positive controls for N1 and N2 with different test kits, but does not show a detection limit for the RP in the protocol.

This document does not state any reason to validate in each test run that specifically the clinical specimen tested is actually from human tissue, but I am sure I have seen that before as a reason for this kind of control/primer probes being used. At least I believe I remember that, I think that is quite important.

One reason for this could be that, other labs/doctors or individuals could send in fake specimen samples; tissue infected with a virus the test was looking for but wouldn't be from an actual patient (named on the specimen) and could even be from an infected animal (not even human). That's one of the primary reason the RP primer is used (IMO) to also validate the extraction of the specimen sample and make sure it is of human specimen- because labs could also erroneously (unintentionally) mix samples up with animal tissues also (in a large inventory of samples collected). I'm pretty sure a probe to detect human DNA in the sample (a gender identifier gene target, I think it doubles as an identifier that the sample is from human tissue also) is also used in forensic DNA fingerprinting PCR tests, there may be a post indicating that in the 9-11 dna evidence thread from 3 years back.


I will note this bias towards a positive result in the absence of RP detection (within the specimen sample wells) is present in this Influenza PCR protocol also (from 2014, page 35 & 36),

CDC Human Influenza Virus Real-TimeRT-PCR Diagnostic Panel(CDC Flu rRT-PCR Dx Panel)
Influenza A/B Typing Kit
https://journals.plos.org/plosone/ar...e.0201248.s007



but is not worded that way in this Influenza PCR protocol (from 2009, page 5 of 7).


https://www.who.int/csr/resources/pu...9_20090430.pdf




Quote:

2. All clinical samples should exhibit RP reaction curves that cross the threshold line at or before 37 cycles, thus indicating the presence of sufficient RNA from human RNase P gene indicating the specimen is of acceptable quality.However, it is possible that some samples may fail to give positive reactions due to low cell numbers in the original clinical sample. Also, samples taken from animal/avian species or cell culture typically exhibit either no RP reaction, or a weak RP reaction. Failure to detect RNase P in any of the clinical samples may indicate:
(a) Improper extraction of nucleic acid from clinical materials resulting in loss of RNA or carry-over of RT-PCR inhibitors from clinical specimens
(b) Absence of sufficient human cellular material in sample to enable detection
(c) Improper assay set up and execution
(d) Reagent or equipment malfunction
We can see here that at some point the interpretation(s) changed, apparently I would assume that in the 2009 protocol a positive for the viral target markers in the absence of RP being detected was not considered an automatic valid positive result without having to be retested. Also important is the wording in (b) here- “(b) Absence of sufficient human cellular material in sample to enable detection” compared to how it is worded in the 2019-nCoV protocol- “Absence of sufficient human cellular material due to poor collection or loss of specimen integrity.”. The main difference in the wording is “to enable detection”- is left out of the 2014 and 2020 protocols; I would think this means “enabling” detection of viral RNA and not just human RNA within a human clinical specimen.


So in essence, seems to me that if extraction failed, than any viral marker showing up should probably be considered either a false positive or an inconclusive and should retest and not simply call it “positive” in one try. This seems like a really bad bias to me. If we could only get some coronavirus pcr experts to weigh in on my analysis, I don't recommend holding our breath for that to happen here(
smh.gif
icon_rolleyes.gif
).


15- multiple specimens at different times needed to “detect” virus, this may be true for other (real) viruses, but the “optimal” time for 2019-nCoV has not been determined (see “b” under the table),

from page 35




Quote:

159415e914415ae02a.png


The wording in b is definitely biased against a "negative" result, therefore making a "positive" result de-facto more likely the more the test is performed on a multiple of specimens collected from each case (patient).


16- Have to consult State Health Lab or CDC for inconclusive results (as opposed to calling them negative?),
from page 35
“If the repeated result remains inconclusive, contact your State Public Health Laboratory or CDC for instructions for transfer of the specimen or further guidance.”

I'm sure the CDC or state labs can get a “positive” if the commercial labs can't, so create more positives to continue fattening the curve.


17- From page 38,


Quote:

Performance Characteristics
Analytical Performance:

Limit of Detection (LoD):

LoD studies determine the lowest detectable concentration of 2019-nCoV at which approximately 95% of all (true positive) replicates test positive. The LoD was determined by limiting dilution studies using characterized samples.

The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since no quantified virus isolates of the 2019-nCoV are currently available, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen.
I'm thinking that normally there is quantified virus isolates to validate test methods normally, here they did their fast-tracked validation with “transcribed” full length RNA of the N gene, from the genome published from this GenBank accession deposit MN908947.2. This is perhaps the second genome version of the original genome published by Chinese scientists (I think on Jan 5th 2020) for the alleged 2019-nCoV virus, subsequently renamed SARS-CoV2 virus.

Is it possible that no quantified virus isolates of the 2019-nCoV were currently available, because they didn't (don't exist)? Is this genome perhaps a mock genome, and this transcribed RNA put into this test validation (and for the 2019-nCoV positive controls also in subsequent actual specimen testing?) was actually artificially printed nucleic acid? I have a hunch (
icon_think.gif
).



Ok, good point to stop and post a few links for DNA printing, will come back to those later,

How We Make DNA

You Tube

The Company Printing DNA - Made To Order | Forbes


Austen Heinz invented a DNA laser printer for you to create new creatures, Part 1

You Tube

To fight the coronavirus, labs are printing its genome
Feb 11020, 10:00am EST
https://www.theverge.com/2020/2/11/2...-biotechnology
 

gl69m

Member
Post #6 (from original thread, from gl69m)
Wanted to add to this thread, a sort of “scientific” look if you will at some of the “evidence' that the new coronavirus (now named SARS-CoV2) is real, or not. I looked at four articles for the 'new' virus, and two articles from the previous SARS outbreak (2002-2004):


Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China
Published:January 24, 2020

Identification of Coronavirus Isolated from a Patient in Korea with COVID-19
Osong Public Health Res Perspect. 2020 Feb; 11(1): 3–7.

Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan, China: a descriptive study
Published:February 24, 2020
(this one was posted by Ruby Gray, post #26 in the Coronavirus thread)

Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China
https://www.thelancet.com/pdfs/journals/lancet/PIIS0140-6736(20)30183-5.pdf
Lancet 2020; 395: 497–506 Published Online January 24, 2020 https://doi.org/10.1016/ S0140-6736(20)30183-5
(This online publication has been corrected. The corrected version first appeared at the lancet.com on January 30, 2020)


Complete Genome Sequences of the SARS-CoV: the BJ Group (Isolates BJ01-BJ04)
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5172409/
Genomics Proteomics Bioinformatics. 2003 Aug; 1(3): 180–192.
Published online 2016 Nov 28. doi: 10.1016/S1672-0229(03)01023-4
PMCID: PMC5172409
PMID: 15629030

Ultrastructural Characterization of SARS Coronavirus
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322934/
Emerg Infect Dis. 2004 Feb; 10(2): 320–326.


First of all, only one of the four papers above for “2019 novel coronavirus' mentioned anything about virus isolation from patients, the paper from Korea. Let's look at virus “isolation” from the other two papers from the previous SARS outbreak (2002-2004) first and then compare “isolation' in the Korean “2019 novel coronavirus' paper.

From the first paper (Complete Genome Sequences of the SARS-CoV: the BJ Group (Isolates BJ01-BJ04))



Quote:

SARS Patients, SARS-CoV Isolates and Genome Sequencing
SARS patients were clinically diagnosed in March 2003 according to World Health Organization (WHO) guidelines (http://www.who.int/csr/sars/guidelines/en/). SARS-CoV isolates were maintained in Vero-6 cell cultures that were inoculated from autopsies and biopsies of the deceased or recovered SARS patients ( Table 1). Viral RNA was purified from virions prepared from the cultures and subjected for cDNA syntheses.A set of primers that cover the entire viral genome were used for the reverse transcription and PCR amplification, in a product size range of 400–800 bp. PCR-amplified fragments were then cloned into amplicon-libraries and two dozens or more clones were sequenced for each PCR-amplified fragments to ensure sequence quality and to avoid errors in the procedures of the RT-PCR and cloning. Only the consensus sequences with absolute majority votes were used for the genome assembly and gene annotation,
So in this paper, it is mentioned that a “virus” was first isolated from the patients and maintained (in Vero-6 cells, it mentions Vero-E6 cells in the second paper) in cell cultures (I don't know how long before they were?) before virions were purified and then used to extract RNA and then sequenced using the RT-PCR methods. This seems to imply that cell cultures with the suspected virus was meticulously kept. I'm guessing the primers used here may be more generic, to simply attach to whatever viral RNA is present, not really diagnostic primers per se, not sure.

From the second SARS paper (Ultrastructural Characterization of SARS Coronavirus);



Quote:

Abstract

Quote:

Severe acute respiratory syndrome (SARS) was first described during a 2002–2003 global outbreak of severe pneumonia associated with human deaths and person-to-person disease transmission. The etiologic agent was initially identified as a coronavirus by thin-section electron microscopic examination of a virus isolate. Virions were spherical, 78 nm in mean diameter, and composed of a helical nucleocapsid within an envelope with surface projections.

Methods

Infected and uninfected Vero E6 cells were harvested 3–5 days after inoculation, inactivated by fixation and gamma irradiation (2 × 106 rad), and processed for standard, immunolabeling electron microscopy


A BAL specimen was obtained from a 47-year-old man within the first week of the onset of symptoms. A portion of the specimen was centrifuged at 2,000 rpm for 10 min, and the pellet was processed for standard EM.
an additional assay using “goat anti-mouse antibody conjugated to 12-nm colloidal gold particles” was used to identify the virus in cultured cells (Vero-E6)


Quote:

IEM and ISH assays were performed essentially as described for Nipah virus (

Quote:

14). In brief, for IEM assays, sections were reacted with hyperimmune mouse ascitic fluid raised against SARS-CoV and then with a goat anti-mouse antibody conjugated to 12-nm colloidal gold particles (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA).


Quote:

Virions acquired an envelope by budding into the cisternae and formed mostly spherical, sometimes pleomorphic, particles that averaged 78 nm in diameter (Figure 1A).
Quote:



Viral proteins and RNA were detected in virions by IEM and ISH (Figure 2A,B), and in association with double-membrane vesicles (Figure 3A,B), nucleocapsid inclusions, and large granular areas of cytoplasm (Figure 4C,D).
03-0913-F2.jpg



03-0913-F3.jpg



03-0913-F4.jpg

Ultrastructural Characteristics of SARS-CoV–Infected BAL Specimen
A number of coronavirus-infected cells were seen within a BAL specimen from a SARS patient (Figure 5A,B). Virus particles budded into, and were associated with, vesicles, and extracellular virions covered the exterior surface of the cells. Areas of double-membrane vesicles containing a diffuse granular material were also seen.

03-0913-F5.jpg
Near the end of discussion for the second paper, we find a very interesting cautionary statement about diagnosis using EM (electron microscopy):



Quote:

Recent studies have reported finding coronavirus particles in lung and gastroenteric tissues of SARS patients and experimentally infected macaques (

Quote:

7,3033), although the viral nature of these structures has not been confirmed by IEM or ultrastructural ISH assays. Coronavirus particles may be confused morphologically with other nonviral structures routinely found in cells, including coated vesicles, multivesicular bodies, perichromatin granules, glycocalyceal bodies, and cellular projections (29). Therefore, a cautious approach is advisable when examining clinical specimens.
Let's look at “isolation' from the Korean paper,



Quote:

3. Virus isolation

Quote:

The virus was isolated from nasopharyngeal and oropharyngeal samples from putative COVID-19 patients. Oropharyngeal samples were diluted with viral transfer medium containing nasopharyngeal swabs and antibiotics (Nystadin, penicillin-streptomycin 1:1 dilution) at 1:4 ratio and incubated for 1 hour at 4°C, before being inoculated onto Vero cells. Inoculated Vero cells were cultured at 37°C, 5% CO2 in 1× Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2% fetal bovine serum and penicillin-streptomycin. Virus replication and isolation were confirmed through cytopathic effects, gene detection, and electron microscopy.


1. Virus isolation from Vero cells

Following inoculation of Vero cells with the nasopharyngeal and oropharyngeal samples, they were observed at 24-hour intervals, and the cytopathic effects were observed from 3 days after inoculation (Figure 1). The inoculated cells were harvested on the 4th day when more than 80% of the cells exhibited cytopathic effects. Virus replication was confirmed using real-time RT-PCR with RNA extracted from the cell culture medium.
ophrp-11-3f1.jpg


2. Analysis of the structure of the virus by electron micrographs

The structure of the virus in the cytoplasm of 3-day post-inoculation cells was examined by electron microscopy (Figure 2). Coronavirus-specific morphology was observed. Virus particle size ranged from 70–90 nm and the virus was observed in a wide range of intracellular organelles, especially in vesicles.

ophrp-11-3f2.jpg
Discussion
As of February 12th, 2020, 28 cases of COVID-19 have been reported in Korea, with the first case observed in a traveler residing in Wuhan, China. The SARS-CoV-2 was isolated from a Korean patient who had self-administered antipyretics for initial symptoms such as chills and fever. The patient had experienced intermittent coughing with sputum 3 days after the administration of antipyretics. The SARS-CoV-2 could replicate in other cells (Vero E6 and Caco-II cells), in addition to Vero cells (data not shown).
This is odd, I thought it said earlier in the paper that Vero cells were used- it didn't specify them as Vero E6 cells? Wasn't worded that way. Not sure what this means, perhaps it means the SARS-CoV-2 replication data (in Vero E6 and Cac-II cells) is not shown in this paper. Are the Vero cell data and images in this paper perhaps from actual patient infections or culture from SARS-CoV infected cells? Just speculation on my part. Weird wording there.

Another weird wording from the discussion section:


Quote:

The first SARS-CoV-2 was successfully isolated by inoculating human airway epithelial cells with bronchoalveolar-lavage fluid samples from a patient with pneumonia [16].Since human airway epithelial cells (because of their resemblance to pseudostratified mucociliary epithelium) require 4–6 weeks to differentiate in vivo, isolation of SARS-CoV-2 using Vero cells or Caco-II cells is more convenient. Further studies are needed to select more sensitive cell lines suitable for virus isolation from low viral load samples.
I'm guessing this means that once the cultured airway cells are inoculated with virus, they take 4-6 weeks to differentiate in the lab before virus can be harvested for study. The first isolation in Wuhan China would have to have been performed in early December, if the virus was supposedly sequenced as of Jan 5th or 7th (I've seen both dates used as submission date of earliest sequencing); from low viral load samples?

Last part of discussion section:


Quote:

Prior to identification of SARS-CoV-2 as the causative agent of the unknown pneumonia in Wuhan, China, pan-CoV RT-PCR was being used to detect SARS-CoV-2 in Korea. The Pan-CoV RT-PCR detects all human coronaviruses and animal-derived coronaviruses (personal communication). Since the release of the SARS-CoV-2 sequence, a real-time RT-PCR method has been established in the diagnosis of COVID-19 patients. Currently, the diagnosis of COVID-19 is based on gene detection via real-time RT-PCR.
I think that perhaps using the “pan-CoV RT-PCR”, what this end paragraph really means is that they are using that (pan-CoV RT-PCR) to detect SARS-CoV or other coronavirus infections in Korea, not SARS-CoV-2, that only came out after the sequence for that had been published. It doesn't really say when they started the study.


Overall, perhaps it is legit, the “isolation' of virus in the Korean study, however the previous study the work looks definitely more detailed for SARS-CoV “isolation” and “identification” of a new virus (back in 2003), than the present Korean study to me. It seems that there may have been at least a 5 month gap before viral “isolation” and subsequent “genome sequencing” occurred in the SARS outbreak, whereas in the current one, could have been only maybe a few weeks; I can imagine it will be argued the technology is better/faster now than it was 17 years ago etc.


I keep thinking that this whole 'pandemic' really is just an outbreak of probably a new strain of the previous SARS-CoV virus. We should ask, how were those outbreaks (SARS 2002-2004, and MERS 2014-2015) so well contained (by the numbers, only about 8400 cases of SARS and maybe over a 1000 cases for MERS) and this one ('SARS-CoV-2) is off the charts comparatively?

Well probably it is just as well contained, except for lying media and extreme fake hype. Plus we will never know who is actually tested for this shit and what the real results are. Maybe the virus isn't actually fake but just a slight mutated version of the previous SARS virus with mythical additions to the genome, alleged by a recombination event in multiple animal hosts (bats and civets). Is it possible, some of the original patients in Wuhan were simultaneously infected with both a previous SARS virus and a bat coronavirus, and the cDNA produced from the “pan-CoV RT-PCR” kits produced an erroneous amalgamated genome from the two viruses? I doubt that's what happened, since all of this in China is surly part of their military participating in the Event 201 “exercise”: which coincidentally the Event 201 tabletop exercise was conducted in The Pierre hotel New York, NY on October 18th 2019, the same day that the Military World Games were commenced in Wuhan China. The seafood market there implicated in the outbreak was also not far from some of the hotels used by visiting military athletes including from the U.S. Surly not just coincidence IMO. Some of the original enrolled patients could have been spiked with printed RNA or their specimen samples were. I have no smoking gun to prove that of course, to prove the SARS-CoV-2 virus is fake of course.


There are more papers dealing with the supposed “isolation' of the new 'virus', but I don't have infinite amounts of time trying to look them up, so I just wanted to add a little piece more to the picture; some of the primers used in the four papers for the novel 2019 coronavirus, I went ahead and used a feature in the NCBI gene bank published genomes called “BLAST”.


For three of these papers, I looked at the primers “BLAST” results against a genome published for the 'new' virus (accession no. MN908947.3) and “BLASTED” them also against a genome published for the previous SARS-CoV virus (accession no. AY278488.2).

Interestingly I got almost the same homology reported back by the BLAST for both genomes for these primers for the first two papers:
Quote:

Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China
https://www.thelancet.com/journals/l...183-5/fulltext
P497-506, February 15, 2020
Published:January 24, 2020
Suspected patients were isolated using airborne precautions in the designated hospital, Jin Yin-tan Hospital (Wuhan, China),


BLAST forward primer5'-ACTTCTTTTTCTTGCTTTCGTGGT-3'
AY278488.2 (nucleic acid)
Query Descr
SARS coronavirus BJ01, complete genome
lcl|Query_50685 (nucleic acid)
Query 26148 ACTTCTTTTTCTTGCTTTCGTGGT 26171
||||||||||||||||||||||||
Sbjct 1 ACTTCTTTTTCTTGCTTTCGTGGT 24

SARS coronavirus BJ01, complete genome
BLAST probe 5'CY5-CTAGTTACACTAGCCATCCTTACTGC-3'BHQ1
Query 26179 CTAGTCACACTAGCCATCCTTACTGC 26204
||||| ||||||||||||||||||||
Sbjct 1 CTAGTTACACTAGCCATCCTTACTGC 26

BLAST reverese primer 5'-GCAGCAGTACGCACACAATC-3'
AY278488.2 (nucleic acid)
Query Descr
SARS coronavirus BJ01, complete genome
Query 26210 GATTGTGTGCGTACTGCTGC 26229
||||||||||||||||||||
Sbjct 20 GATTGTGTGCGTACTGCTGC 1


Query ID
MN908947.3 (nucleic acid)
Query Descr
Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome .
BLAST forward primer 5'-ACTTCTTTTTCTTGCTTTCGTGGT-3'
Query 26295 ACTTCTTTTTCTTGCTTTCGTGGT 26318
||||||||||||||||||||||||
Sbjct 1 ACTTCTTTTTCTTGCTTTCGTGGT 24

BLAST probe 5'CY5-CTAGTTACACTAGCCATCCTTACTGC-3'BHQ1
Query 26326 CTAGTTACACTAGCCATCCTTACTGC 26351
||||||||||||||||||||||||||
Sbjct 1 CTAGTTACACTAGCCATCCTTACTGC 26

BLAST reverse primer 5'-GCAGCAGTACGCACACAATC-3'
Query 26357 GATTGTGTGCGTACTGCTGC 26376
||||||||||||||||||||
Sbjct 20 GATTGTGTGCGTACTGCTGC 1


Identification of Coronavirus Isolated from a Patient in Korea with COVID-19
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7045880/
Osong Public Health Res Perspect. 2020 Feb; 11(1): 3–7.

AY278488.2 (nucleic acid)
Query Descr
SARS coronavirus BJ01, complete genome

forward primer ACAGGTACGTTAATAGTTAATAGCGT
Query 26122 ACAGGTACGTTAATAGTTAATAGCGT 26147
||||||||||||||||||||||||||
Sbjct 1 ACAGGTACGTTAATAGTTAATAGCGT 26

(Probe in 5-FAM/3'-BHQ format ACACTAGCCATCCTTACTGCGCTTCG
Query 26185 ACACTAGCCATCCTTACTGCGCTTCG 26210
||||||||||||||||||||||||||
Sbjct 1 ACACTAGCCATCCTTACTGCGCTTCG 26

reverse primer ATATTGCAGCAGTACGCACACA
Query 26213 TGTGTGCGTACTGCTGCAATAT 26234
||||||||||||||||||||||
Sbjct 22 TGTGTGCGTACTGCTGCAATAT 1


MN908947.3 (nucleic acid)
Query Descr Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome .

BLAST 5'-ACAGGTACGTTAATAGTTAATAGCGT-3' (Forward)
Query 26269 ACAGGTACGTTAATAGTTAATAGCGT 26294
||||||||||||||||||||||||||
Sbjct 1 ACAGGTACGTTAATAGTTAATAGCGT 26

5'-ACACTAGCCATCCTTACTGCGCTTCG-3' (Probe in 5-FAM/3'-BHQ format).
Query 26332 ACACTAGCCATCCTTACTGCGCTTCG 26357
||||||||||||||||||||||||||
Sbjct 1 ACACTAGCCATCCTTACTGCGCTTCG 26

5'-ATATTGCAGCAGTACGCACACA-3' (Reverse)
Query 26360 TGTGTGCGTACTGCTGCAATAT 26381
||||||||||||||||||||||
Sbjct 22 TGTGTGCGTACTGCTGCAATAT 1
But from the third paper, they didn't exaclty match up for either one very well it seems to me, except for the third primer with the reporter/quencher probe attached I suppose.



Quote:

Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan, China: a descriptive study
P425-434, April 01, 2020
Published:February 24, 2020
81 patients who were admitted to Wuhan Jinyintan hospital (n=49) or Union Hospital of Tongji Medical College (n=32) between Dec 20, 2019, and Jan 23, 2020


AY278488.2 (nucleic acid)
Query Descr
SARS coronavirus BJ01, complete genome
BLAST Forward primer TCAGAATGCCAATCTCCCCAAC
no significant similarity found

BLAST 5'CY5-CTAGTTACACTAGCCATCCTTACTGC-3'BHQ1.
Query 26179 CTAGTCACACTAGCCATCCTTACTGC 26204
||||| ||||||||||||||||||||
Sbjct 1 CTAGTTACACTAGCCATCCTTACTGC 26

BLAST reverse primer AAAGGTCCACCCGATACATTGA
no significant similarity found


MN908947.3 (nucleic acid)
Query Descr
Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome ...

forward primer 5'-TCAGAATGCCAATCTCCCCAAC-3'
Query 19156 CATTCTGA 19163
||||||||
Sbjct 8 CATTCTGA 1

BLAST probe 5'CY5-CTAGTTACACTAGCCATCCTTACTGC-3'BHQ1
Query 26326 CTAGTTACACTAGCCATCCTTACTGC 26351
||||||||||||||||||||||||||
Sbjct 1 CTAGTTACACTAGCCATCCTTACTGC 26

reverse primer 5'-AAAGGTCCACCCGATACATTGA-3'
Query 24215 GGTTGGACCTTT 24226
|| |||||||||
Sbjct 12 GGGTGGACCTTT 1
Kinda weird, the last one I would think would match up at least better than that with the genome published for the new virus, but I can't claim to be any expert at using the “BLAST” or setting all the parameters of the search exactly or properly, maybe it's there but I probably don't know how to use it very well, just started trying it.

Just judging by that from the first two sets of primers “BLASTED”, I would think that SARS-CoV virus could also be detected by using them in the assay, if it were present in a specimen tested. The CDC PCR protocol claimed to have tested it against a wide variety of related viral species, but the results they show appear to only have done 3 samples each, I guess; not really very robust it seems to rule out false positives (to me anyway). The CDC protocol also does not publish the primers used for detection of the N1 and N2 gene targets (Nucleocapsid gene, a different gene than the gene {envelope gene} used on the tests in the Chinese and Korean studies), so I cannot try to “BLAST” the CDC primers against the two different genomes.


In the 4th paper (Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China, “Data Collection” on page 499) it states the data collected was from Dec 16th 2019 to Jan 2nd 2020, 3 weeks which seems too short of time to grow the human airway epithelial cells (take 4-6 weeks to grow/differentiate) supposedly used to “isolate” the new virus; and seemingly before a PCR test using primers gleaned from the published genome of supposed virus was available, so how where these patients “laboratory confirmed” for infection with 2019-nCoV? And that it also states “To ascertain the epidemiological and symptom data, which were not available from electronic medical records, the researchers also directly communicated with patients or their families to ascertain epidemiological and symptom data.”; seems kind of weird that “ epidemiological and symptom data” would not be available in the electronic medical records?

Also Detection of coronavirus in plasma was done in plasma but not whole blood, they used the term RNAaemia instead of viraemia, not sure how legit this term is (“RNAaemia was defined as a positive result for real-time RT-PCR in the plasma sample.”).

In the Results section, page 503, it says “Similarities of clinical features between 2019-nCoV and previous betacoronavirus infections have been noted. In this cohort, most patients presented with fever, dry cough, dyspnoea, and bilateral ground-glass opacities on chest CT scans. These features of 2019-nCoV infection bear some resemblance to SARS-CoV and MERS-CoV infections.20,21 However, few patients with 2019-nCoV infection had prominent upper respiratory tract signs and symptoms (eg, rhinorrhoea, sneezing, or sore throat), indicating that the target cells might be located in the lower airway.” However, on page 501 it says “Clinical presentations greatly resemble SARS-CoV.”


And it also says that (page 504) “Our study has some limitations. First, for most of the 41 patients, the diagnosis was confirmed with lower respiratory tract specimens and no paired nasopharyngeal swabs were obtained to investigate the difference in the viral RNA detection rate between upper and lower respiratory tract specimens. Serological detection was not done to look for 2019-nCoV antibody rises in 18 patients with undetectable viral RNA.” It seems that most of the testing in the U.S. seems to come from upper respiratory nasopharyngeal swabs, I think.

on page 504


Quote:

Both SARS-CoV and MERS-CoV were believed to originate in bats, and these infections were transmitted directly to humans from market civets and dromedary camels, respectively.35 Extensive research on SARS-CoV and MERS-CoV has driven the discovery of many SARS-like and MERS-like coronaviruses in bats. In 2013, Ge and colleagues36 reported the whole genome sequence of a SARS-like coronavirus in bats with that ability to use human ACE2 as a receptor, thus having replication potentials in human cells.37


I also found a paper that actually found serological evidence in China of coronaviruses in bats actually infecting humans,
Serological Evidence of Bat SARS-Related Coronavirus Infection in Humans, China
Published online 2018 Mar 2.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6178078/



Quote:

These results indicate that some SARSr-CoVs may have high potential to infect human cells, without the necessity for an intermediate host. However, to date, no evidence of direct transmission of SARSr-CoVs from bats to people has been reported.

Quote:


His-tagged nucleocapsid protein (NP) of the following viruses were expressed and purified in E. coli for this study: SARSr-CoV Rp3; human coronaviruses (HCoVs) HKU1, OC43, 229E, NL63; Middle East Respiratory Syndrome Coronavirus (MERS-CoV); and Ebola virus (EBOV). In addition, the receptor binding domains (RBD) of the spike protein (S) from SARS-CoV, bat SARSr-CoVs Rp3, WIV1, and SHC014 were produced in mammalian cells (Ge et al. 2013; Yang et al. 2016).
Polyclonal antibodies against each of the six NPs were prepared in rabbits as previously published (He et al. 2006). Cross-activity was evaluated with ELISA and Western blot (Supplementary Figures S1, S2). No significant cross-activity was detected among NPs and their corresponding antibodies for Rp3, MERS-CoV, NL63, or 229E. Cross-reaction was detected between OC43 and HKU1 as reported previously (Lehmann et al. 2008).

None of the sera reacted with NPs of either MERS-CoV or EBOV. On the other hand, all 10 human sera (9 from Jinning and 1 from Wuhan), regardless of their Rp3 NP reactivity, reacted strongly with the NL63 NP as expected due to high prevalence of NL63 infection in humans worldwide (Abdul-Rasool and Fielding 2010).
NL63 is apparently another coronavirus infecting humans,
Understanding Human Coronavirus HCoV-NL63.
https://www.ncbi.nlm.nih.gov/pubmed/20700397/


Quote:

Abstract
Even though coronavirus infection of humans is not normally associated with severe diseases, the identification of the coronavirus responsible for the outbreak of severe acute respiratory syndrome showed that highly pathogenic coronaviruses can enter the human population. Shortly thereafter, in Holland in 2004, another novel human coronavirus (HCoV-NL63) was isolated from a seven-month old infant suffering from respiratory symptoms. This virus has subsequently been identified in various countries, indicating a worldwide distribution. HCoV-NL63 has been shown to infect mainly children and the immunocommpromised, who presented with either mild upper respiratory symptoms (cough, fever and rhinorrhoea) or more serious lower respiratory tract involvement such as bronchiolitis and croup, which was observed mainly in younger children. In fact, HCoV-NL63 is the aetiological agent for up to 10% of all respiratory diseases. This review summarizes recent findings of human coronavirus HCoV-NL63 infections, including isolation and identification, phylogeny and taxonomy, genome structure and transcriptional regulation, transmission and pathogenesis, and detection and diagnosis.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2918871/

Remember I also posted a paper in post#5 of this thread (as bias #6) that stated that there should be expected sero-anti-body-antigen cross-reactivity with antibodies between SARS-CoV and SARS-CoV-2, based on conservation of the Nucleocapsid (N) gene in particular,

Systematic Comparison of Two Animal-to-Human Transmitted Human Coronaviruses: SARS-CoV-2 and SARS-CoV

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7077191/


Quote:

As the most abundant protein in CoVs, nucleocapsid (N) protein is highly conserved across CoVs [91]. The N protein in SARS-CoV-2 shares ~90% amino acid identity with that in SARS-CoV [28], which indicates that antibodies against the N protein of SARS-CoV would likely recognize and bind the N protein of SARS-CoV-2 as well. N antibodies do not provide immunity to SARS-CoV-2 infection, but the antibodies have a cross reactivity with SARS-CoV N protein viruses, which would allow a serum-based assay to identify the asymptomatic SARS-CoV-2 infected-cases [28].
so clearly, based on sequence homology, they predict that sero-cross reactivity should occur here, and many of the new quick rapid tests will surly be using sero-anti-body reaction tests, with which surly many false positives and more fattening of the curve will occur for 'covid-19' (so-called asymptomatic carriers). The reference in this above paper, (28 ) that paper states that all of Koch's postulates have not yet been fulfilled for SARS-CoV-2 particularly re-testing/isolation in animal models to prove it causes the disease in question.


I wonder if prevalence of many different varieties of human coronaviruses are now showing up as false positives in most of the (PCR) testing going on to supposedly detect SARS-CoV-2 (alleged 'covid-19', some study now “withdrawn” of course were stating up to 80% false positive rate in China). The newer "isothermal" PCR machines (Abbott ID NWO) will undoubtedly add more fat to the curve as well. Not claiming to have proven that here, but I still don't see any reason upon looking at the available evidence why that possibility should be dismissed IMO.
 

gl69m

Member
Post #7 (from original thread, from nrms)
The PCR tests should not be used for diagnostic purposes according to the inventor of the test. Interesting guy! Maverick to say the least.


Post #8 (from original thread, from nrms)
Does anybody have any info on the antibody test?

(edit: Sorry, I see it now)
Tough going for me though. I'm going to need to be on the lookout for a laymans (me) guide or piece from a virologist (etc) that can break it down to be easily digestible.


Great work gl69m!

Post #9 (from original thread, from gl69m)
Quote:


Originally Posted by nrmis (post #8 ) View Post

Does anybody have any info on the antibody test?

(edit: Sorry, I see it now)
Tough going for me though. I'm going to need to be on the lookout for a laymans (me) guide or piece from a virologist (etc) that can break it down to be easily digestible.


Great work gl69m!
Thanks a bunch nrmis, really preciate the vote of confidence very much. I try to bring forth a serious and truthful analysis of the evidence I can find, obviously I am highly opinionated, I try to back up that opinion the best way I have the knowledge to do so. I don't claim to have proven my opinions, I am not any super expert in scientific matters, I do have a Biology degree and science background. I know that I do share some specific opinions about things that we here consider truth and falsehood with quite a few people here, no complete agreement of course.

The evidence is very strong that the media does not tell us the what the real truth is, about most big controversial events of course but much more than just that. We can see that this 'pandemic' is no exception to that rule.


I will be working on looking into the antibody tests soon, I did have a brief look at the new Abbott IDNWO, er I mean IDNOW testing machines and the "iso-thermal" PCR testing, about a week and a half ago, haven't sat down to put any work into that yet, but I will start pretty soon. I don't think these tests and machines have been rolled out full force as yet, if they are being used in some places I've not looked into that yet. Sorry, just a little lazy at getting to it, I'm still working full time (thankfully) it does need to be looked at for sure.


I was curious to ask you nrmis, you mentioned in this thread How to deal with Covid 19, (http://letsrollforums.com//showpost.php?p=279339&postcount=3), that you had two friends that had allegedly come down with 'covid-19', one of them died.



Quote:

What would that prove? Anyone who goes near a hospital or catches a cold 'has coronavirus'.
And I'm saying that with two of my best mates close friends apparently (1) injured and (1) killed by 'covid19'.
I wanted to ask, you had talked directly to the friend that survived?, did they volunteer information about how/when they were supposedly tested, they had proof of lab testing/results to show you or said they did? How about your friend that passed away, did their family members volunteer any such information? If they hadn't it is kind of understandable, most people prefer privacy in general anyway.

I know of only two people that have been at least supposedly "tested' for the 'covid-19', one of them told me of being "tested" at least two weeks ago or longer, have not heard of a result (either way, + or -) at all so far. Won't do me any good to speculate, and I'm not going to ask this person and they may not ever volunteer the information so I really don't know at this time. The other person I know, is more elderly and just recently fell ill (has lots of pre-existing health issues) and supposedly has been "tested' maybe a day or a few days ago I don't know any date of supposed testing right now.

Post #10 (from original thread, from nrms)
http://letsrollforums.com//showpost....&postcount=130


That link might help you re: my friends OF friends. To be clear, the people killed/injured are NOT known to me. The 2 guys relaying their stories are very well known to me. They have stated 'killed/injured by the virus'. That is what they believe. Why wouldnt they? I did.

I've found out that the guy who died was 41, former rugby player, worked in security. Repeatedly told to self-isolate, did so for 14 days, found dead at home on the 15th day.
Other guy 51, on a ventilator. I sent my pal (who is good friends with the victim) the Dr Cameron Kyle-Sidell video in private. Didn't reply, I am wary of pushing.
Some more info...
A friend of mine made a fb post asking if anyone knew anyone 'with coronavirus' Several replies, mostly someones parent/grandparent. Only young one was a 37-year old apparently with worried spouse because his breathing was so shallow (Scotland, unknown).
Then one of his pals sent him a vid that his brother had put out after being ill, basically telling people to 'listen to their body' and get to the hospital regardless of the telephone advice if they felt they needed to.
I will try and post it here.
I'm sure he mentions 'being diagnosed cv19 by chest x-ray'
You might be able to give me some idea of how reasonable and accurate it might be to diagnose a virus through a chest x-ray?
One more, friend of mine 'had it'. Said she thought she was going to die briefly. I dont want to downplay anything here, buy I've felt like that with a cold/flu. I've absolutely stated before (couple of years back) 'wow, its a bit mad how I'm having to seriously concentrate on breathing'.
If that had happened to me a few weeks ago... can you imagine how that messes with people?
She also said one of her clients had died 'of it'.
Unfortunately, I'm unlikely to garner anymore information there as we are not speaking now as i had the audacity to go to work.
 

gl69m

Member
Post #11 (from original thread, from nrms)
I got sent this yesterday. California Doctor using the official figures and their own figures. 'Its not as bad as flu' was the takeaway if I remember rightly...

http://youtu.be/BTLii-e_UtY


uncle bill finds numbers from serology tests 'not very interesting'.
He goes on to state that the pcr test is 'very sensitive'. Which is BULLSHIT according to the inventor of the test.
From 14.55 https://www.cnbc.com/video/2020/04/09/watch-cnbcs-full-interview-with-microsoft-co-founder-bill-gates-on-past-pandemic-warnings.html

Post #12 (from original thread, from gl69m)
@nrmis (post #10)


Quote:

http://letsrollforums.com//showpost....&postcount=130


That link might help you re: my friends OF friends. To be clear, the people killed/injured are NOT known to me. The 2 guys relaying their stories are very well known to me. They have stated 'killed/injured by the virus'. That is what they believe. Why wouldnt they? I did.
Sorry nrmis, I had interpreted your original wording wrong, these are friends of friends, third hand information about 'covid-19' related cases, not your direct friends then. My bad.



Quote:

I'm sure he mentions 'being diagnosed cv19 by chest x-ray'
You might be able to give me some idea of how reasonable and accurate it might be to diagnose a virus through a chest x-ray?
Right now about that I will refer you to these two posts here about what I said previously about x-rays/CAT lung scans and 'covid-19'-

http://letsrollforums.com//showpost....1&postcount=29

http://letsrollforums.com//showpost....0&postcount=45



Quote:

I raised that concern in post #29, what part of that do you not understand Ruby?

Quote:
People can have the same disease yet have slightly different appearances on scans and x-rays.

Some of those scans showed several sequential slices on the same patient, showing different appearances from slice to slice. That is par for the course.
One other major point of my post is, maybe you didn't perceive it I guess, people can have different diseases (different causes) and have very similar appearances on scans and x-rays. You say in post #43 that you can read the scans Quote:
I have had a long career in hospitals and private practice so I can read the CT scans and understand the medical terminology.
, so this means that you can tell apart (without fail) which patients have lung damage caused by drugs or chemicals or other disease agents as opposed to the alleged new 'Covid-19' virus? Are you sure? Really really sure??
If anybody can tell the difference between the lung scans in post #29 between "patients with indium lung include PAP patterns and interstitial fibrosis patterns" and that of the alleged 'covid-19' patients, please kindly point out the most obvious difference/distinctions, thank you.

If you want me to nrmis, I can dig more up about x-ray/scans of various diseases compared to alleged 'covid-19' scans, I'll leave it at that for now though.


From nrmis (post #11)



Quote:

I got sent this yesterday. California Doctor using the official figures and their own figures. 'Its not as bad as flu' was the takeaway if I remember rightly...

http://youtu.be/BTLii-e_UtY




uncle bill finds numbers from serology tests 'not very interesting'.
He goes on to state that the pcr test is 'very sensitive'. Which is BULLSHIT according to the inventor of the test.
From 14.55

https://www.cnbc.com/video/2020/04/0...-warnings.html
The California doctor seemed to me to be saying that 'covid-19' is basically equivalent to the flu, however, if the numbers are total bullshit about that, in other words they have not proven (at all) who really has the alleged 'new virus' and who doesn't let alone who gets sick or doesn't or who actually dies from it, or in worst case scenario we are right and there is no such virus: so in any case no real comparison to the flu can be made until we have the truth about the alleged 'new virus', right now there is no proof worth fucking dogshit whatsoever offered of the truth of these 'covid' numbers, so we have no actual comparison with the "flu" to make as of yet and no comparison can ever be made if the the 'new virus' is entirely a hoax i.e. does not exist (any such comparison then will be obviously totally fraudulent).


About uncle bill, I didn't catch where he said the serology test numbers were uninteresting, do you have a time stamp in the video where he says that? Thanks.
 

gl69m

Member
Post #13 (from original thread, from nrms)
From 14.55 in the gates video gl69m.


It does make me wonder what the cali doc is up to. Do they know something is not adding up and have deicided something along the lines of.. fk it, we'll do lots of their pcr tests (designed to be ambiguously positive?). And we'll do our own sero tests (I've NO IDEA what these show, whose narrative they would help, Gates didn't seem keen which I found intriguing) to show that even more people 'have had it'. And show the numbers for what they are. This is obviously pure speculation on my part.

Watching that Gates video made me wonder if their own bs tests might backfire slightly on them. TOO MANY people positive and not enough dead. Contingency will be in place no doubt.

Thanks for the x-ray info, will check it out.

Post #14 (from original thread, from nrms)
Coronavirus: Government orders 50 million new testing kits after development 'breakthrough'

The government has reportedly ordered 50 million new coronavirus test after scientists in Oxford made a “breakthrough” in developing the new form of kit.

The kits will cost £10 and tell users if they have coronavirus using a similar two-line system to pregnancy tests.

Post #15 (from original thread, from gl69m)
@nrmis (post #13),




Quote:

From 14.55 in the gates video gl69m.


It does make me wonder what the cali doc is up to. Do they know something is not adding up and have deicided something along the lines of.. fk it, we'll do lots of their pcr tests (designed to be ambiguously positive?). And we'll do our own sero tests (I've NO IDEA what these show, whose narrative they would help, Gates didn't seem keen which I found intriguing) to show that even more people 'have had it'. And show the numbers for what they are. This is obviously pure speculation on my part.

Watching that Gates video made me wonder if their own bs tests might backfire slightly on them. TOO MANY people positive and not enough dead. Contingency will be in place no doubt.

Thanks for the x-ray info, will check it out.
Preciate the response nrmis.

Regarding the interview with uncle bill, I went back to listen from about 14:30 thru till about 16:30 in, and he did say that the sero numbers were uninteresting because supposedly the extreme measures taken to 'slow the spread' has infected too few number of people (he says probably will result in about 10 million "infected' in U.S.) so therefore is not a meaningful amount of "herd immunity" (natural as opposed to induced {i.e. by vaccination et al}), according to him of course. He says the interesting part is "researching' whether or not 'recovered' 'covid' patient's blood (therefore supposed antibodies in blood against 'SARS-CoV-2') can be useful in creating "treatments'/'therapies' for 'covid'.

He goes onto say that the serological tests (knowing if people have supposedly been exposed or infected with the new 'virus' by "testing' if they have antibodies that can bind to the protein antigens {recombinant that is} of the 'SARS-CoV-2') (paraphrasing) " is more about understanding the science than it is being about actionable individually", I think what he probably means is that knowing if people supposedly have these antibodies is really more qualitative and subjective than really hard data that people have really been infected with the (alleged) virus or not. I'm certain that most of the talking head medical "experts" (and the politicians too) really know this but tout the serological tests as almost as more objective and specific than they really are, i.e. they are lying about it.

I say "qualitative and subjective", because as I have said before in other posts, that antibodies are quite "promiscuous" proteins, meaning that they can bind to multiple different antigens and antigens (antigens are general a protein or a protein part of the structure of a microbe) from different species (i.e. different viruses and bacteria or other microbes etc.). This I was taught while I was in college at SUIE in the 90s and also at STL Comm. College in 2002-2003. And so these other bindings can cause false positives and false negatives, and weak positives and other testing interference etc., so that interpretation of results can be difficult and often be erroneous. It will surly be argued that these tests have gotten better and more specific etc. over time than they used to be, but I doubt that that is really true, but obviously I can't directly prove that either.

He says that the PCR test is more sensitive, and technically I agree that a proper test method and rigorously tested protocol and reagents in the tests thoroughly tested, should definitely be more specific and accurate in detecting a microbe than a serological test (which is more indirect since it is really looking for antibodies and not the actual microbe, and the PCR looks for the microbe's RNA or DNA). However of course, the PCR tests still have significant problems in accuracy, especially if not validated properly or they are rigged and the testing abused to deliver results that are desired (i.e. increasing numbers of positive even if most are false positives), at least I believe it can be manipulated that way, even if I cannot obviously directly prove that.


Uncle bill says that the PCR tests are the key to finding "positives' and then induce "contact tracing" and "quarantining" etc., we have already seen that as happening, although we very rarely ever know who has really tested "positive' except for celebrities and politicians, let alone how many people have really been tested. Then bill says "serological" only goes positive after you've already infected about everybody you're going to infect", that's not paraphrased I think he really said that.


"we'll do lots of their pcr tests (designed to be ambiguously positive?)."

Yeah I would say that is true, I think I've shown that with the biases of the CDC PCR protocols in the earlier posts of this thread.

Well, I think the sero numbers can cut a couple of different ways for the 'coronavirus pandemic' narrative; if the numbers show high number of people allegedly have been exposed, than yes so-called death rate appears to be lower, but if lower numbers are shown than they can claim the social dipshitting and bans on social gatherings did the job of "flattening the curve" and supposedly slowed the spread and 'saved lives'. Either way, they can obviously spin it in favor of the whole official 'coronavirus pandemic' narrative- i.e that the virus is real, and anybody skeptical who think the virus is a hoax (or at least the 'covid' numbers inflated and manipulated) will still be labeled as tin foil hat wearers.


I know that I need to dig in and take a detailed look at the serological (antibody) tests, and the rapid diagnostic tests and machines that use the "isothermal PCR", and I will do that, but I'm really slow at it, so it will take me while to get those posts out, it takes several hours or more for me to sit down and digest those and try to break it down in an understandable way for lay person's as it were (and hell to break it down more understandable for myself also), and then assess whether or not there is potential for "scientific" fraud in the use of these tests. I have to post some back ground material about antibodies and antibody detection testing also for anybody to get a decent understanding of it too. I'm kind of a slow typer too, so hopefully I will maybe post something about it by the end of this coming weekend or maybe next week, and unfortunately, the more detail to explain this stuff, the longer the posts are too.

I will start out with a post to explain antibodies and antibody testing with this site,

Types of antibodies
Structure and characteristics of antibody isotypes



it looks pretty useful and simplistic with relatively good diagrams to visualize the structural concepts of the antibodies. Then I will try to look at and break down a couple of different serological/antibody tests that seem to be trying to sell their kits for 'covid-19' serological testing at this time.

Cellex qSARS-CoV-2 IgG/IgM Rapid Test

https://www.fda.gov/media/136625/download

CD Creative Diagnostics
SARS-CoV-2 Antigens and Antibodies




After that, I will try and find some articles that deal more specifically with problems of false positives in the serological/antibody tests.

Post #16 (from original thread, from nrms)
I dont envy your task! I wish you Luck! Incredible to me that you are going through this, dunno how you do it gl69m
icon_salut.gif


Thought popped into my head... have they said/would there be any truth in them saying something along the lines of 'we have vastly improved the sensitivity/accuracy of the original PCR tests'?
IF that happened/has happened, would Kary B Mullis say they are talking out of their arse?
(apologies if you have actually covered this already!)

Post #17 (from original thread, from gl69m)
@nrmis (post #16)



Quote:

I dont envy your task! I wish you Luck! Incredible to me that you are going through this, dunno how you do it gl69m
icon_salut.gif


Thought popped into my head... have they said/would there be any truth in them saying something along the lines of 'we have vastly improved the sensitivity/accuracy of the original PCR tests'?
IF that happened/has happened, would Kary B Mullis say they are talking out of their arse?
(apologies if you have actually covered this already!)
Thanks again for the vote of confidence nrmis, really appreciate that
icon_salut.gif
.

My analysis and my opinions would carry more weight perhaps if I had stronger credentials, higher degrees or did more biotech work than I have for employers. But what I have as credentials will not carry much weight to get most average sheople reading what I put up here, to wake up a little to question any of this nonsense unfortunately.


Regarding the sensitivity/accuracy of the PCR tests, I'm sure it will be argued in the mainstream that they are better than they used to be, perhaps that is true, at least for some viruses and bacteria. I'm really not sure what Kary B Mullis would say about it now if her were still alive, I never read that much about his stance in years past, I would suspect that if he saw problems with their testing methods now surely he would point them out.

My own personal feeling about the PCR tests is that in principle they should be more sensitive/accurate than the serological/antibody tests; but obviously no test is perfect. I also think that in the microbiology lab, detecting specific strains of microbes out of lab culture material is probably quite a bit better (more accurate/sensitive) than detecting them out of human patient specimens, there usually can be a lot more other germs (other than what the test is trying to detect) and body tissue cell/debris in the specimens that can cause false positives and interferences, especially upper airway specimens (throat swabs, that have been reported as the more common specimen used to test for 'covid-19'). But I can't claim right now to be able to prove that opinion with out quoting other scientific "sources" of course.




I will get to the antibody/serology tests, I promise, but like I said, I'm pretty slow at it, bear with me, thanks to anybody following what I am posting.
 

gl69m

Member
Post #18 (from original thread, from gl69m)
So, from post #15, let's continue with background information for antibodies before delving into the Cellex kit and the CD Diagnostic antigen product catalog.

Types of antibodies
Structure and characteristics of antibody isotypes


What are antibodies?



Quote:

Antibodies are proteins produced and secreted by B cells. They bind to foreign substances that invade the body, such as pathogens.

The term “antibody” refers to its function, which is to bind to an antigen. Another name for this protein molecule is immunoglobulin (abbreviated Ig).


Antibodies are Y-shaped molecules, consisting of two heavy chains (H chains) and two light chains (L chains) arranged as shown in the diagram on the right.

An antigen binds to the antigen-binding site at the tip of the “Y.” An important feature is that each antibody recognizes a specific antigen as illustrated in the diagram. This is called "antibody specificity".(Details are described below.
Structure and characteristics of antibody isotypes

Human antibodies are classified into five isotypes (IgM, IgD, IgG, IgA, and IgE) according to their H chains, which provide each isotype with distinct characteristics and roles.


Quote:

This looks to be easy to visualize in general the shape of antibody (proteins). Haven't thought about this information all that much since I saw this stuff back at SIUE, maybe only a smidgen covered at STL Comm. College. I think it looks accurate as compared to what I generally remember after looking at this site. I did revisit antibody information some when I used to research about HIV testing back in the late 90s and 2000s.


Antibody class specific information,


Quote:

IgG
IgG is the most abundant antibody isotype in the blood (plasma), accounting for 70-75% of human immunoglobulins (antibodies). IgG detoxifies harmful substances and is important in the recognition of antigen-antibody complexes by leukocytes and macrophages. IgG is transferred to the fetus through the placenta and protects the infant until its own immune system is functional.
IgM
IgM usually circulates in the blood, accounting for about 10% of human immunoglobulins. IgM has a pentameric structure in which five basic Y-shaped molecules are linked together. B cells produce IgM first in response to microbial infection/antigen invasion.
Although IgM has a lower affinity for antigens than IgG, it has higher avidity for antigens because of its pentameric/hexameric structure. IgM, by binding to the cell surface receptor, also activates cell signaling pathways.
IgA
IgA is abundant in serum, nasal mucus, saliva, breast milk, and intestinal fluid, accounting for 10-15% of human immunoglobulins. IgA forms dimers (i.e., two IgA monomers joined together). IgA in breast milk protects the gastrointestinal tract of neonates from pathogens.
IgE
IgE is present in minute amounts, accounting for no more than 0.001% of human immunoglobulins. Its original role is to protect against parasites. In regions where parasitic infection is rare, IgE is primarily involved in allergy.
IgD
IgD accounts for less than 1% of human immunoglobulins. IgD may be involved in the induction of antibody production in B cells, but its exact function remains unknown.
Antibodies present on B cell lymphocytes; the diagram shows very simplisticly how different antibodies are derived from the base genetic material (the genes) our cells have to produce antibodies.


Quote:

Immunoglobulin class switching

Quote:


B cells expressing plasma membrane-bound IgM and IgD (mature B cells) are activated upon encounter with a specific antigen, and begin to proliferate and produce secretory IgM and IgD. With further activation by the antigen or other stimuli, these mature B cells differentiate into cells that produce increasing amounts of secreted immunoglobulins, and start to produce immunoglobulin isotypes other than IgM and IgD. This process is called “immunoglobulin class switching”.
Factors in the B cell environment (including hormones secreted by T cells [cytokines]) direct the isotype switching.
Examples

Interleukin 4 (IL4) stimulates class switching from IgM/IgD to IgG1 and IgE
Interleukin 5 (IL5) stimulates class switching from IgM/IgD to IgA
*Interleukins are a type of cytokine that is produced by leukocytes and lymphocytes during the immune response
The role of antibodies



Quote:

The three functions of antibodies

Quote:

Antibodies have three main functions:
1) Antibodies are secreted into the blood and mucosa, where they bind to and inactivate foreign substances such as pathogens and toxins (neutralization).
2) Antibodies activate the complement system to destroy bacterial cells by lysis (punching holes in the cell wall).
3) Antibodies facilitate phagocytosis of foreign substances by phagocytic cells (opsonization).
I will point out that the diagram is incorrect in that the size scale of the antibodies appear significantly larger than virus particles when they are not, antibodies are ~10 nanometers in size and viruses generally range from 20 nanometers to 400 nanometers in size. Despite that, the concept of the artistic illustration of antibody binding to viruses and bacteria in the diagrams I believe is accurate.
Antibodies function in the Immune System


Quote:

Antibodies and the four key features of the immune system

Quote:

1. Specificity of antibodies: Antibodies precisely recognize toxins and pathogens.
2. Diversity of antibodies: Antibodies against a variety of antigens preexist in the body.
3. Immunological memory: We don’t don’t develop symptoms of measles
4. Immune tolerance: Self cells and tissues are not normally attacked.


The specificity of antibodies

Each antibody recognizes one specific antigen.


For example, an antibody that recognizes the mumps virus cannot recognize the measles virus. Conversely, an antibody that recognizes the measles virus cannot recognize the mumps virus. This feature is called “antibody specificity.”

Each B cell (antibody-producing cell) produces one kind of antibody. However, pathogens produce millions of harmful factors.

Then, how does the body defend itself against countless harmful factors?
I feel compelled to stop right here to point out that part of what it says here is not technically correct well at least not all the time or not 100% of the time.



Each antibody recognizes one specific antigen.”

This is basically true but not 100% of the time, this is what I meant when I say antibodies are quite “promiscuous” and each one can bind multiple antigens, least from what I remember being taught. The relative strength and specificity of binding of an antibody is usually significantly lower or a lot lower for any other antigen than the one antigen it is “most” specific for. However, those other bindings are the crux of the issue when it comes to using serological antibody testing when it comes to generating false results, false positives and also false negatives, but also other inconsistent or inconclusive results. I will show that the concept of absolute specificity of the antibody for one antigen only as they imply here is contradicted in the section “Main causes of non-specific reactions”, which I will get to shortly (well actually in the next post).

3. Immunological memory: We don’t don’t develop symptoms of measles”

I'm really not sure what the hell this means (the two don'ts together don't make a do
biggrin.gif
), I don't know how to interpret this exactly; but I think it means simply memory of the antigen of a pathogen like measles virus is carried on antibodies specific for measles those antibodies are carried on memory B cells, sometimes many years even after initial infection, and since are still present can be used if the body is exposed to that same measles virus again conferring immunity. (no symptoms upon any subsequent exposure).


Going to skip “The diversity of antibodies and immunological memory” for now and go onto “Gene rearrangement”.



Quote:

Gene rearrangement

Quote:


Antibody-producing B cells are produced in the bone marrow and mature in the periphery. During B-cell maturation, the antibody genes (immunoglobulin genes) undergo recombination, generating an enormous repertoire of antigen-binding sites (the variable region). This phenomenon is called “gene rearrangement.”

The gene locus encoding the H chain variable region:


The locus contains an array of about 100-300 V gene segments, about 25 D gene segments, and 6 J gene segments. One each of the V, D, and J gene segments are selected and joined together.

The gene locus encoding the L chain variable region:
There are two loci: κ and λ.
The κ locus consists of an array of about 40 V and 5 J gene segments. The λ locus consists of an array of about 30 V and 4 J gene segments. One each of the V and J gene segments are selected and joined together.

Immunoglobulins (antibodies) to countless antigens are produced from a limited number of genes by recombination of gene segments. Gene rearrangements also occur during T cell maturation in the thymus.
If anybody is somewhat confused by the diagram, how the “gene arrangement” occurs when antibodies are made after initial infection, how the H (heavy) and L (light) chains of the variable region are made to be “antigen specific”, don't feel bad I don't fully understand it myself. I was exposed to that explanation in certain classes, but obviously it's been a minute, I don't remember for certain right now, not going to bother pulling up another source to describe that.

I think I remember it as the DNA available for antibody production (in the diagram, V, D, and J on H chain, and V and J on the L chain); I think an initial antibody among the large number of variable ones already floating around in the body (Antibodies against a variety of antigens preexist in the body), the closest possible binding fit antibody latches on to a microbe or it's antigen/protein floating around, mostly in blood or lymph or extracellular fluids, and this then latches onto a Memory B cell I think, the constant chain end (Fc region) onto the B cell surface receptors. A change occurs that somehow the B cell uses the information on the variable antibody bound to the antigen, to splice the DNA in the variable encoding regions with DNA cutting enzymes, and then enzymes ligate them back together to get DNA or maybe it's RNA that will code for the new better fit more specific antibody that can bind to the antigen. Perhaps a few rounds of this happen initially, and the antibody from the B cell that is the best fit, more prolific, ends up being the one that reproduces the most, and make a lot more of those antibodies to fight the infection.


If I have that wrong, I can try correct that later, moving on.

I'm going to cover the next section I'm moving onto, “How to generate antibodies”, as briefly as I can, it's quite lengthy with multiple diagrams, but it is very relevant to these type of serological test kits, for most if not all of the types of antibodies used in these kits are produced this way as far as I know.


Quote:

How to generate antibodies by immunizing animals with an antigen (immunogen)

Quote:

∙ How to generate polyclonal antibodies

∙ How to generate monoclonal antibodies

How to generate antibodies without immunizing animals

∙ Phage display method

Related topics

∙ Difference between polyclonal and monoclonal antibodies

∙ How to purify antibodies

How to generate polyclonal antibodies

Overview of the procedure


An antigen (immunogen) injected into animals induces them to produce and secrete high levels of antibodies into the blood. Several months after repeated immunization, the blood (plasma, serum) is collected, and antibodies are purified (by methods described later). The antibodies generated by this method are called polyclonal antibodies because they are derived from different B cell clones and the resulting antiserum contains numerous different antibodies that react to the injected immunogen.
Now if the kits coming out now have antibodies created against 'sars-cov-2' produced by this method, I suppose there has been enough time to create them (just barely!) from lab animals, if genome of 'sars-cov-2' published in early January. Notice it says an “An antigen (immunogen)” is “injected”, not the microbe (or virus) itself. I will reiterate that the antigens (proteins in particular) can undoubtedly come from printed DNA/RNA and then transcribed proteins by that via bacteria or other cell cultures. Did they use that in this case?, right now I can only suspect that they could have, I don't have smoking gun proof.

Animals used for immunization (immunized animals)



Quote:


In addition to mice and rabbits, various mammals and birds are used for immunization, including rats, hamsters, guinea pigs, chickens, goats, sheep, and donkeys.

Immunoglobulin isotypes, organization of immunoglobulin genes, mechanism of diversification, and the organ sites of antibody diversification differ between vertebrate animals.
I have to wonder how specific are these to antigen as compared to the human antibodies? They can't be exactly the same as human antibodies. And can these animal produced antibodies be antigens them selves to other antibodies in our blood that are not specific for that antigen? Maybe I can get more answers about that in this site and other sites.


Quote:

How antibodies are produced

Quote:


After immunization, blood IgM levels increase first.
With repeated immunization, IgG levels increase.


The affinity (binding ability) of IgM for the antigen does not increase even after repeated immunization.

In contrast, the binding ability of IgG increases with repeated immunization.
*AZ's point shows us that “non-specific' antibodies can also be produced by this process, generally if the immunization period is too long,


Quote:

AZ_point.png

Dangers of hyperimmunization!
Extending the immunization period, in the hopes of developing a higher affinity antibody to the antigen, is not necessarily beneficial. After an excessively long immunization period, non-specific antibodies, including self-reactive antibodies, increase in amount and the animals’ health may deteriorate. To generate high quality antibodies, it is important to periodically collect a small amount of blood and evaluate the affinity of the antibody for the antigen and non-specific reactions.
however, this does not seem to be reflected on the second graph, but perhaps if it were extended on the X axis over time from the third immunization this would start to occur. Perhaps maybe it begins to occur before that time, but that would be mere speculation on my part, but if the animals blood is not checked regularly in less than optimal lab schedule conditions or bad quality control oversight maybe this happens and if not checked, than they are likely producing less than optimal quality antibody lots.





Quote:

How to produce monoclonal antibodies


A single antibody (monoclonal antibody) can be stably produced if a single B cell producing the antibody is isolated and cultured indefinitely.
This is achieved by artificially fusing the antibody-producing B cells with immortalized cancer cells (myeloma) to generate hybridomas that live indefinitely and contain genes encoding specific antibodies, and by selecting the hybridoma clones that produce the desired monoclonal antibodies with high affinity and specificity.

It usually takes 4-6 months from immunization of animals to production of monoclonal antibodies.
There perhaps has been enough time, probably just barely, to produce monoclonal antibodies to 'sars-cov-2', the Cellex kit (Cellex qSARS-CoV-2 IgG/IgM Rapid Test
https://www.fda.gov/media/136625/download ) says it has “Monoclonal Anti-SARS-CoV-2 antigen conjugated on the membrane.” in the kit Composition listing. Right now I don't know the exact method used or the source, where Cellex Inc. either produced or they get these antibodies from another company.

Quote:

Difference between clones in monoclonal antibodies

Quote:


Even though monoclonal antibodies against the same antigen are produced each clone reacts to different epitopes on the same antigen Also, each clone have different suitable applications. It is important to take note of the antigen name and clone name when selecting a monoclonal antibody.
Difference between polyclonal and monoclonal antibodies

Polyclonal antibodies
Monoclonal antibodies
Animal species
Rabbit, guinea pig, goat, sheep, rat, mouse, chicken, etc.
Rat, mouse, chicken, rabbit, human, etc.
Form
Antiserum
Hybridoma
Class, subclass
Mixed classes
Single class
Epitope
React to multiple epitopes
React to a single epitope
Specificity
Lower than monoclonal antibodies because multiple types of antibodies are present.
High if good quality antibodies are selected.
Reproducibility
Variable among lots.
The same antibodies are produced indefinitely.
Stability
Binding ability tends to be unaffected by fixation/denaturation of the antigen, because multiple different antibody molecules are present.
Tolerate modifications, such as labeling and removal of the Fc region.
Binding ability may be lost if the epitope is lost by fixation/denaturation of the antigen, because monoclonal antibodies are homogeneous.
Tend to be sensitive to modifications, such as labeling and removal of the Fc region.

Antigen binding


Antigen binding

Monoclonal antibody reacts to a single epitope. Therefore, only one antibody molecule can bind to an antigen molecule.
In contrast, polyclonal antibody is a collection of immunoglobulin molecules that react against a specific antigen, each recognizes a different epitope. Therefore, multiple antibody molecules bind to an antigen molecule. (if sufficiently large).


Labeled (secondary) antibodies

Similarly, only one antibody molecule can bind to a primary antibody molecule if the secondary antibody is a labeled monoclonal antibody. Whereas multiple antibodies can bind to a primary antibody molecule if the secondary antibody is a polyclonal antibody.

Consequently, polyclonal antibodies provide a higher sensitivity of detection (amplification of the signal) and, therefore, are commonly used as a secondary antibody.

Sensitivity to protein-degrading enzymes (proteases)


Proteases are often used for antibody modification in order to add a label, or to remove the Fc region to reduce non-specific reaction.

The high sensitivity of monoclonal antibodies to protease digestion can result in digestion outside the intended regions, or loss of antigen-binding ability. Conversely, if the antibody is resistant to the protease, intended modifications would be difficult.

In contrast, sensitivity to proteases is unlikely to cause a problem with polyclonal antibodies, and antigen-binding ability tends to be unaffected because multiple different antibody molecules are present. Thus, polyclonal antibodies are amenable to modification.
”Proteases are often used for antibody modification in order to add a label, or to remove the Fc region to reduce non-specific reaction.”
That seems a bit curious that why would a protease step be needed to remove the Fc region, perhaps the heavy-light chain binding region are then spliced onto a different Fc region from some other antibody to, as they say reduce non specific reactions?, or to add a “label” to the antibody. Not exactly sure, not going to look into that any further right now.


Labeled antibodies

https://ruo.mbl.co.jp/bio/e/support/method/conjugated.html

I'm just going to paste some of the diagrams here for illustration and cut this a little briefer:


Quote:

Application example of fluorescent-labeled antibody: Immunofluorescence staining
Immunofluorescence staining with an antibody to an organelle marker
HeLa cells were stained with an antibody to the Golgi protein GM130.

Application example of enzyme-labeled antibodies: Immunohistochemical staining

Colloidal gold
Cut this post off here, and continue with the next post...
 

gl69m

Member
Post #19 (from original thread, from gl69m)
Moving on to interject The Cellex kit, it mentions it's test strip pad in the test cassette has-

https://www.fda.gov/media/136625/download


Quote:

(from page 1)

Quote:

1) a burgundy colored conjugate pad containing SARS-CoV-2 recombinant antigens conjugated with colloidal gold (SARS-CoV-2 conjugates)
159415eb2f533eef8f.png
Exactly what produces the burgundy color of the line I'm not sure of right now, the colloidal gold seems to be used primarily to be viewed under electron microscope from what I have seen, obviously a microscope of any kind is not used with these test cassettes the lines being directly visualized by naked eye.

A color line developing in these kinds of tests seems to me more like that of the Immunohistochemical staining, ELISA or Western Blot, all of these usually have an enzyme coupled to a secondary antibody that binds to a primary antibody- this being the antibody the test is trying to detect (if present in the sample specimen) since it will bind to the antigen, or alternatively a manufactured primary antibody is used to detect the microbe antigen (usually protein, in this case would be viral) if present in the sample specimen.

I think this test would be an example of an antibody capture, the two lines G (IgG) and M (IgM) contain anti-human antibodies (does not say what animal species these were produced from) which bind to the Fc region of the supposed human anti-sars-cov-2 antibody (if supposedly present of course).


So let's break down this Cellex kit just a little further before I go onto the section “Main causes of non-specific reactions” (false positives, false negatives, etc.).


Quote:

(from page 1)

Quote:

INTENDED USE:

The Cellex qSARS-CoV-2 IgG/IgM Rapid Test is a lateral flow immunoassay intended for the qualitative detection and differentiation of IgM and IgG antibodies to SARS-CoV-2 in serum, plasma (EDTA, citrate) or venipuncture whole blood specimens from patients suspected of COVID-19 infection by a healthcare provider. The qSARS-CoV-2 IgG/IgM Rapid Test is an aid in the diagnosis of patients with suspected SARS-CoV-2 infection in conjunction with clinical presentation and the results of other laboratory tests.

Results from the qSARS-CoV-2 IgG/IgM Rapid Test should not be used as the sole basis for diagnosis.

Negative results do not preclude SARS-CoV-2 infectionand should not be used as the sole basis for patient management decisions.


IgM antibodies may not be detected in the first few days of infection; the sensitivity of the qSARS-CoV-2 IgG/IgM Rapid Test early after infection is unknown.

False positive results for IgM and IgG antibodies may occur due to cross-reactivity from pre-existing antibodies or other possible causes.

At this time, it is unknown for how long IgM or IgG antibodies may persist following infection.

For prescription use only. For in vitro diagnostic use only. For emergency use authorization use only.

(from page 2)

Whole Blood
1.Drops of whole blood can be obtained by venipuncture. Do not use hemolyzed blood for testing. The Cellex qSARS-CoV-2 IgG/IgM Rapid Test has not been tested with fingerstick specimens. Use with fingerstick blood is not recommended.

2.Whole blood specimens should be stored at 2-8° C ̊ if not tested immediately. The specimens must be tested within 24 hours of collection.

TEST PROCEDURE

Step 1: For fresh samples, begin with Step 2. For frozen samples, bring the specimens and test components to room temperature, and mix the specimen well once thawed.

Step 2: When ready to test, open the pouch at the notch and remove the test device. Place the test device on a clean, flat surface.

Step 3: Label the device with specimen ID number.

Step 4: Using a transfer pipette, transfer serum, plasma or whole blood, careful not to exceed the specimen well. The volume of the specimen is around 10μL. For better precision, transfer specimen by a pipette capable of delivering 10μL of volume. The specimen into the center of the sample well (S well) making sure that there are no air bubbles. Then, add 2 drops of Sample Diluent immediately into the sample well (S well).

Step 5: Set up a timer.

Step 6: Read the results in 15-20 minutes. Don’t read results after 20 minutes. To avoid confusion, discard the test device after interpreting the result.

QUALITY CONTROL

1.Internal Control: This test contains a built-in control feature, the C Line. The C Line develops after addition of the specimen and sample diluent . If the C Line does not develop, the test is invalid. Review the procedure and repeat the test with a new device.

2.Positive and Negative Control: Positive and negative controls should be tested to ensure the proper performance of the assay, particularly under the following circumstances:
break here to keep quote insert from being too long


Quote:

INTERPRETATION OF ASSAY RESULT

Quote:

1.Valid Assay


1.1 In addition to the presence of the C Line, if only the G Line is developed, the test result indicates the presence of IgG anti- SARS-CoV-2 virus. The result is IgG positive or reactive, consistent with a recent or previous infection.

1.2 In addition to the presence of the C Line, if only the M Line is developed, the test indicates the presence of IgM anti-SARS-CoV-2 virus. The result is IgM positive or reactive, consistent with an acute or recent SARS-CoV-2 virus infection.

(from page 3)

1.3 In addition to the presence of the C Line, if both G and M Lines are developed, the test indicates the presence of IgG and IgM anti-SARS-CoV-2 virus. The result is IgG and IgM positive or reactive, suggesting current or recent SARS-CoV-2 virus infection.

Negative results do not rule out SARS-CoV-2 infection, particularly for patients who have been in contact with known infected persons or in areas with high prevalence of active infection. Follow-up testing with a molecular diagnostic test is necessary to rule out infection in these individuals.

Results from antibody testing should not be used as the sole basis to diagnose or exclude SARS-CoV-2 infection.


False positive results may occur due to cross-reacting antibodies from previous infections, such as other coronaviruses, or from other causes

Samples with positive results should be confirmed with alternative testing method(s) and clinical findings before a diagnostic determination is made.
Very important “disclaimers” I bolded above, quiet admission of either fallibility of the test, or rigging, but not claiming to have proven that with this posting of course.


Valid and Invalid assay pictorial.


Quote:

(Valid Assay)

Quote:

159415eb2f53427c44.png

159415eb2f5343688b.png
Right now, I'm not sure that the control line can really rule out a “false positive” of say cross reaction with antibodies developed from infections from other coronaviruses (particularly the ones identified with common colds). It seems that if the control line does not show up, either there is no capture antibodies (goat anti-rabbit IgG) bound to the strip at the C line or would indicate that there might not be any or enough rabbit IgG-gold conjugate on the sample well membrane pad. If the latter was the case (no rabbit IgG-gold), how exactly would any of the lines C, G or M) develop at all? If the former (no capture goat anti-rabbit IgG) this would seemingly only affect the C (control) line anyway and the G and M lines could still develop if they had the capture antibodies on these lines.

If a lot of these tests turned out to perform like that, then a lot more kits would end up getting used, more money for Cellex possibly, and it would seem that this could possibly conceal the true number of false positives if the discarded test kits that had one of the three of the four examples outcomes in the Invalid Assay (not the first one with no lines); if none of the discarded tests were counted as false positives and maybe simply not recorded at all, or that data is not always shown anyway.


Another point I want to make is, notice there are three possibilities for a weak reaction for a Valid Assay, and of course interpretation of these as “positive” will probably vary by test user and location etc. These could also be “false positive” weak cross-reactivity but will likely very seldom be counted as such. Only one result can be interpreted as a “negative” result, 1 out of 7 possible outcomes, does seem biased towards “positive”, but I'm not saying that is rigging in and of it's self.

However the wording “Negative results do not rule out SARS-CoV-2 infection, particularly for patients who have been in contact with known infected persons or in areas with high prevalence of active infection.” definitely is mentally imprinting towards a “positive' result for the healthcare practitioners administering the tests and doctors doing the diagnoses.

Page 3 and 4 also go into Clinical Performance studies, some serum or plasma samples from RT-PCR “positive' for SARS-CoV-2 patients were used to test this test kit.


Quote:

Positive Percent Agreement (PPA)= 120/128 (93.8%),95% CI: 88.2% to 96.8%

Quote:

Negative Percent Agreement (NPA)= 240/250 (96.0%), 95% CI: 92.8% to 97.8%
96% negative agreement I believe would indicate a 4% false positive rate. According to some experts, that's not too good, somewhat high rate.
From at least one article I found,

When laboratory tests can mislead even when they appear plausible

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6297641/
2017 Aug


Quote:

ABSTRACT

A laboratory test has three phases, pre-analytical, analytical and post-analytical. The purpose of this review is to highlight an issue concerning the analytical phase of one of the most widely deployed groups of in vitro diagnostic tests using a common technology – namely immunoassay.
Immunoassay entails an inherently high error rate and, therefore, has the potential for inaccurate and misleading results susceptible to misinterpretation and/or diagnostic misapplication by clinicians. An approach based on Bayesian inference (without mathematics or equations) – illustrated by examples – is presented; this may help clinicians in discerning potentially erroneous results even when they appear plausible and not unreasonable.

Essentially, false positive results are most likely to occur when the disease prevalence/incidence is low. False negative results become more prominent when the prevalence/incidence of disease increases. When concern is raised, available follow-up laboratory tests should be initiated to establish with confidence the diagnostic reliability or unreliability of such results.

Examples of misleading results

It would be realistic in practice for clinicians to exercise extra care before accepting and acting on potentially misleading results carried out by immunoassay, even when they appear plausible and not unreasonable. This can be achieved by grasping the concept underpinning probabilistic reasoning. This is exemplified here (avoiding equations and unnecessary mathematics) using two illustrative scenarios, namely (1) thyroid-stimulating hormone (TSH) in the diagnosis of subclinical hypothyroidism and (2) troponin in patients presenting with chest pain suspicious of acute coronary syndrome.

Prevalence of subclinical hypothyroidism and utility of TSH in diagnosis

Subclinical hypothyroidism has a low prevalence of 1% or less in young adults and children but much higher incidence of approximately 17% in older women.10,11

The immunoassay used to measure TSH may be assumed to have an excellent diagnostic accuracy of 99.6% and an error rate of ±0.4% (considered among the lowest reported).1–9 This means four false positives or negatives are predicted per thousand in any population sample.

In a 1,000 sample of the low (1%) prevalence group (young adults and children), the number of individuals with genuine subclinical hypothyroidism (ie truly raised TSH) would be anticipated to be 10.However, including the 4 false positives, there would be a total of 14 cases in which TSH is raised, and potentially interpreted as consistent with the diagnosis. This equates in this cohort to a test sensitivity of about 70% and an error rate of about 30% (4/14).

Conversely, in 1,000 samples of the higher (17%) prevalence group (older women), the corresponding figures would be 170 and 174 – ie a test sensitivity of about 98% and an error rate of about 2% (4/174).
Now that is an assay for TSH with 99.6% accuracy with 0.4% false positive error rate, so if we apply a 4% false positive rate to a low prevalence population (1%) for any disease, then instead of 4/14 it would become 40/50, or 20% true positive and 80% false positive. I've seen that statistical fact brought up in other articles in the last month or so. That would just be extrapolation of the initial clinical performance study, maybe not what the clinical performance would actually end up being of course.
The Cellex pdf on the end of page 3 to page 4 shows claims of testing for Assay Cross Reactivity, for a panel of different viruses (including Human coronavirus panel (collected before Oct 2019)), and Potentially Endogenous Interfering Substances.

I'm sure all of these can and do cause false positives, otherwise companies wouldn't be made to test their kits against them. They do not show any data on the test results (number of samples tested or pictorals of kit results) but claim there was no false positivity or false negativity was found with any of those tested. I realize in a short document that a lot of data and results would probably not be shown, sometimes perhaps a link to the data or a further study is provided, I don't see any links in this document for any of the clinical performance studies.

Someone could always try to contact the company of course to get that kind of data, my experience in the past has been little to no response for those kind of inquiries. If they suspected you to be a “conspiracy theorist”, then we know what kind of run around you would get.


Limitations of the Cellex kit,


Quote:

LIMITATIONS OF THE PROCEDURE

1.The Assay Procedure and the Interpretation of Assay Result must be followed closely when testing for the presence of SARS-CoV-2 virus specific antibodies in the serum, plasma or whole blood specimen from individual subjects. For optimal test performance, proper sample collection is critical. Failure to follow the procedure may give inaccurate results.

2.The qSARS-CoV-2 IgG/IgM Rapid Test is limited to the qualitative detection of antibodies specific for the SARS-CoV-2 virus. The intensity of the test line does not necessarily correlate to SARS-CoV-2 antibody titer in the specimen.(also subject to user interpretation here for weak positive reactions)

3.A negative or non-reactive result can occur if the quantity of antibodies for the SARS-CoV-2 virus present in the specimen is below the detection limit of the assay, or the virus has undergone minor amino acid mutation(s) in the epitope recognized by the antibody detected by the test.

4.If symptoms persist and the result from the qSARS-CoV-2 IgG/IgM Rapid Test is negative or non-reactive, it is recommended to re-sample the patient a few days later or test with an alternative test device.

5.The results obtained with this test should only be interpreted in conjunction with clinical findings, and the results from other laboratory tests and evaluations.

6.This test should not be used for screening of donated blood
The second site I was going to look at is CD Creative Diagnostics,



https://www.creative-diagnostics.com/news-sars-cov-2-antigens-and-antibodies-79.htm


Quote:

SARS-CoV-2 Antigens and Antibodies

Quote:

SARS-CoV-2 (2019-nCoV) is a new type of bat coronavirus identified as the cause of an outbreak of respiratory illness first detected in Wuhan, China. Early on, many of the patients in the outbreak in Wuhan, China reportedly had some link to a large seafood and animal market, suggesting animal-to-person spread. However, a growing number of patients reportedly have not had exposure to animal markets, indicating person-to-person spread is occurring. At this time, it’s unclear how easily or sustainably this virus is spreading between people.

Genome analysis of SARS-CoV-2 (2019-nCoV) showed that SARS-CoV-2 (2019-nCoV) was slightly different from SARS CoV and MERS CoV, but the functionally important ORFs, ORF1a and ORF1b, and major structural proteins such as the spike (S), membrane (M), envelop (E) and nucleic capsid (N) proteins are well annotated.



(Here are some of the antigens (recombinant viral proteins), notice the host cell these are produced in, where a plasmid (of the viral gene) must be inserted into the culture cells genome and grown in vats to produce the proteins. Are these proteins and their binding “epitopes” exactly the same as the native actual virus protein (and on the virus itself not broken apart) would be, I would have to think there would at least be minor differences, that at least could affect cross-reactivity with antibodies developed from other virus species or strains (i.e. other coronaviruses et al also).)

SARS-CoV-2 Antigens
Target
Cat.No.
Product Name
Host


S Protein
DAGC158
Recombinant SARS-CoV-2 Spike(S1+S2 ECD) Protein [His]
Insect Cells
DAGC159
Recombinant SARS-CoV-2 Spike Protein [His]
Yeast
S1 Protein
DAGC091
Recombinant SARS-CoV-2 Spike Protein 1 [His]
HEK293
DAGC092
Recombinant SARS-CoV-2 Spike Protein 1 [human Fc]
HEK293
DAGC093
Recombinant SARS-CoV-2 Spike Protein 1 [mouse Fc]
HEK293
DAGC138
Recombinant SARS-CoV-2 Spike Protein 1
HEK293
DAGC157*
Recombinant SARS-CoV-2 Spike 1 Protein (truncated, 30 KDa) [His]
E. coli


DAGC155*
Recombinant SARS-CoV-2 Nucleocapsid Protein (truncated, N3) [His]
E. coli
DAGC156*
Recombinant SARS-CoV-2 Nucleocapsid Protein (truncated, 28 KDa) [His]
E. coli
*Highly recommended for the SARS-CoV-2 antibody lateral flow immunoassay development.
Notice the highly recommended protein antigens for lateral flow immunoassays, we have seen that the Cellex test kit is a lateral flow immunoassay kit. Notice also that the host cells producing it are E. coli bacteria, a prokaryotic cell. Insect cells, yeast and HEK293 (not sure but I would think these are human or animal cancer immortal cell lines) are all eukaryotic, so in principle the protein tertiary and full sub-unit assemblies would be more closer to original structural (3D) confirmation and epitope (amino acid 3D) structure than from prokaryotic cells, I believe that is the case.

Also, the Nucleocapsid genes remember are more conserved across all coronaviruses than most other elements/proteins of the genomes and therefore a higher chance to have cross-reactivity in the serological and pcr tests if other coronaviruses and antibodies in response to were present. At least I certainly believe that to be true. I'm sure it will be argued they are doing enough to quell that kind of objection or criticism of doubt towards the accuracy and specificity of these tests.

All of these test though so far I have seen have been fast-tracked by the FDA and get to self test their own validation, and when huge money is on the line for these companies, are they really going to be that honest? And if they have high level intel operatives working there (if it could be proven of course) who are in on the “live exercise”, we would know that ways to rig a test and appear valid should not be dismissed.


What do some of the “experts” say about some of the new antibody testing? Only going to paste snippets for brevity, not to selectively “quote mine” (I'm sure accusation could be leveled though).

expert reaction to announcement by Roche of its new serology test for COVID-19 antibodies

https://www.sciencemediacentre.org/expert-reaction-to-announcement-by-roche-of-its-new-serology-test-for-covid-19-antibodies/
April 17, 2020


Quote:

The health care company Roche has announced its new serology test for COVID-19 antibodies.

Quote:

Dr Robert Shorten, Chair, Microbiology Professional Committee, Association for Clinical Biochemistry and Laboratory Medicine, said:

“Antibody testing is not routinely performed to detect infections caused by respiratory viruses, such as influenza or other cold viruses. Any test that measures antibodies must be thoroughly validated to ensure that it accurately detects antibodies to SARS-CoV-2 whilst not cross-reacting with normally circulating coronaviruses.


Prof William Irving, Professor of Virology, University of Nottingham, said:


“It is difficult to say much more about the test and its efficacy, as there are no data in the announcementrelating to the sensitivity and specificity of the test. One of the key worries about antibody tests is whether or not they also pick up antibodies to other human coronaviruses which have been circulating in humans as a cause of the common cold for centuries.




Prof Michael Hopkins, a Professor in the Science Policy Research Unit at the University of Sussex Business School with 20 years of experience studying diagnostic testing innovation, said:

“This test would be very useful in helping to understand who has already had the virus (estimating its progression through the population) and this an important test for identifying people that could donate blood that could be used as a convalescent plasma (or serum) therapy that could potentially be used in treating patients severely ill with the virus.”

(We saw that the Cellex kit states it is not recommended for screening donated blood, I suppose meaning after donated blood has been collected that is. Perhaps Roche test kit makes claims for use for that, don’t know haven't looked at them yet)


Prof Babak Javid, Principle Investigator, Tsinghua University School of Medicine, Beijing and Consultant in infectious diseases at Cambridge University Hospitals, said:


Roche doesn’t provide any information about the specifics of the test, e.g. what is the target protein of SARS-CoV2 that it uses in the test, and what is the sensitivity and specificity of the assay using validated samples (e.g. from serum of people known to have recovered from COVID-19, and from serum taken in 2019 before COVID-19). This is important, since some antibody tests may “cross-react” with proteins from common cold coronaviruses. Even with a test with 90% specificity, if <10% of the population has had Covid-19 but a substantial proportion have had the common cold, most of the ‘positive’ results will be “false positives” if everyone is tested.


Dr Al Edwards, School of Pharmacy, University of Reading, said:

“Roche is not alone- there are other major diagnostics companies producing similar tests for their laboratory instruments, such as Abbott ARCHITECHT, and these seem to be being launched. “We still need to understand what antibody test result means, but one vital tool in that process is to have as many standardised tests run with the same protocol. Hopefully these industrial tests will all produce similar results and help us to gain a more systematic understanding of antibody responses. Many of the research studies published so far show the expected pattern of antibody responses, but often each lab is using a different test protocol, making it hard to compare different studies.


Prof Eleanor Riley, Professor of Immunology and Infectious Disease, University of Edinburgh, said:

“From the look of it, this will be lab based assay for analysis of large banks of serum samples, so not suitable for home testing but potentially useful for population based studies and community testing. And it is good news that a large pharmaceutical company, with a very good track record of producing high quality products and the capacity for mass production of test kits, thinks it has something worth rolling out. But, there are no details in the press release about the antigens used for the test or its performance (i.e. no data on sensitivity or specificity) so we can’t yet say whether this is the assay we have all been waiting for.”


Dr Simon Clarke, Associate Professor in Cellular Microbiology, University of Reading, said:

“This is a very interesting and potentially important advance in being able to diagnose who has been previously exposed to the coronavirus causing covid19, but I think the authorities in the UK would be wise to conduct independent evaluation, given how they’ve had their fingers burnt with other tests that they’ve purchased. Moreover, this test will require space and manpower in testing laboratories in addition to equipment already made by the manufacturer. It remains unclear how quickly laboratories that do not already have that particular instrument would be able to obtain them and at what cost.”

https://www.roche.com/media/releases/med-cor-2020-04-17.htm

All our previous output on this subject can be seen at this weblink:

www.sciencemediacentre.org/tag/covid-19


Declared interests


None received.
Now I will cover the section “Main causes of non-specific reactions” from my background information site (https://ruo.mbl.co.jp/bio/e/support/...-reaction.html). I will note that none of these “non specific reactions” or causes of false positives cover cross reactions of non-specific antibodies present in the specimen samples, except heterophilic antibodies (the rheumatoid factors I am not sure from this what their interference is) but this is not a reaction where those antibodies actually bind to the antigen (immunogen) itself but to a capture antibody Fab non antigen binding region (such as the anti human IgG capture antibody on the C and M lines of the pad of the Cellex kit strip). I will illustrate what I mean after pasting this sectional explanations:


Quote:

Various non-specific reactions of antibodies
Non-specific reactions should always be considered even if the data seem clear.

Non-specific reactions can make truly negative samples look positive (false positives) and truly positive samples look negative (false negatives).

Main causes of non-specific reactions of antibodies

Fc receptors
Non-specific reactions of a secondary antibody
Heterophilic antibodies
Rheumatoid factors

Fc receptors

False positive signals may occur when samples (cells and tissues) express receptors for the Fc portion of the antibody molecule (Fc receptors).

Non-specific reactions of a secondary antibody

Secondary antibodies are selected based on the species of animal used to generate the primary antibody. When using a polyclonal secondary antibody, a portion of the secondary antibody may react with proteins of other animal species.

Heterophilic antibodies

Human blood sometimes contains antibodies that bind to mouse antibodies. These antibodies are called human anti-mouse antibody (HAMA). Antibodies that react with antibodies of other animal species include goat (HAGA), sheep (HASA), and rabbit (HARA) antibodies.
These antibodies are collectively called “heterophilic antibodies”.

The exact reason for the presence of heterophilic antibodies is unknown. HAMA can be found in a significant proportion of healthy individuals who have never been exposed to mice.

Rheumatoid factors

Human blood may contain antibodies that react with human antibodies. A well-known example is autoantibodies commonly found in patients with rheumatoid arthritis. They are typically IgM-type immunoglobulins specific for the Fc fragment of human IgG and called rheumatoid factors (RFs).
Although RFs are directed against the Fc fragment of human antibodies, they also react with antibodies of other species, causing false positives/negatives in tests that use mouse antibodies.
In antibody-based clinical tests, interference from RFs in the samples should not be ignored, because RF levels are high in a few percent of rheumatoid arthritis patients and healthy individuals, and in about ten percent of the elderly. False reactions do not only reduce the reliability of the test, but also endanger the lives of misdiagnosed patients.
Now to illustrate what I mean by the antibody cross reaction as I believe I understand it, let's take the first illustration,
and let's replace the Primary antibody pictured in blue with any other antibody present in the blood/plasma/serum that could have come from say a recent common cold coronavirus infection (not going to illustrate that, just picture mentally a green antibody in the illustration to replace the blue one):
and if these antibodies have the same serolgy isotype (same Fc coding region, bottom of the Y shape of the antibody molecule, say an IgG antibody), than if it is present and the alleged anti-sars-cov-2 antibody is not and it cross reacts and binds with the sars-cov-2 antigen (recombinant colloidal gold conjugate in the case of the Cellex kit), then surely a false positive could be produced.


Surley I think this kind of false positive to other coronaviruses is what some of the seven experts quoted in the Science Media Centre article is talking about.

Post #20 (from original thread, from gl69m)
I need to make a couple of minor corrections to post #19 regarding the Cellex kit, but going to have to wait until Friday or over the weekend.
 

gl69m

Member
Post #21 (from original thread, from nrmis)
Amazing gl69m!!
I'm coming across a few stories now where a husband and wife are taking antibody tests and they are getting one positive and one negative.

Post #22 (from original thread, from Vikking911)

Here we have it straight from the horse.

UK Healthcare Worker Says COVID-19 Testing Kits Do Not Work

https://www.thebernician.net/uk-healthcare-worker-says-covid-19-testing-kits-do-not-work/

Post #23 (from original thread, from gl69m)
@nrmis (post #21),
Quote:

Amazing gl69m!!
I'm coming across a few stories now where a husband and wife are taking antibody tests and they are getting one positive and one negative.

Preciate that very much nrmis, I hope what I have put up here is reasonably understandable also. I am still working on the few minor corrections on post #19, but I discovered a change in the Cellex kit pdf (2 actually), the document is not the same as when I posted post #19, I think it is all the same except for just two changes that I noticed. I will include that in the correction post, coming soon hopefully.

@Viking911 (post #22)
Quote:

Here we have it straight from the horse.

UK Healthcare Worker Says COVID-19 Testing Kits Do Not Work

https://www.thebernician.net/uk-heal...s-do-not-work/

Good article Viking, thanks appreciate that. One critique though is that for sheople who trust authority blindly, they may not act too convinced that the tests, pcr or antibody and particularly the antibody, is rigged for false positives especially detecting other species/strains of coronaviruses; not without showing some details of how (mechanism) and examples of some tests/kits doing that.

I'm trying to give a minimal explanation on how the mechanism of cross reactivity (with other strains {viral RNA} or non-specific antibodies) can cause false positives, but without studies or independent testing, like that of the kits tested in Tanzania by giving "blind" non-human samples to the lab and naming them as people; then we couldn't show in actuality the principle of false positivity being confirmed.

Also, in the article, it says that pcr testing (I assume they mean in general) cannot determine a "viral load" which I think just means basically the number of virus particles- concentration per unit (say milliliters) of blood or body fluid. I would agree that it most likely isn't very accurate in actual bodily tissue specimens, and the promoters of determining "viral load" like they were shown to be full of shit for HIV know this. For other viruses, maybe it's more accurate, I really don't know.

But I will say that real time quantitative PCR can indeed perform well in a lab and titer a very low number of cells or perhaps virions too. When I worked at Clean Earth, a colleague I worked with developed a method to use real time PCR to determine a very low number of cells (bacteria) to start with and made curves showing that the original titer number (either something like 2, 5, 10 or 20 cells to start) can be determined. I used his protocol to repeat it for him to determine operator reproduce-ability and I was able to get the same results he did when I repeated it twice. Of course, that is coming from serial dilutions of pure bacterial culture into just pure phosphate buffer, not the same at all as determining a cell or virion titer number from a bodily tissue specimen with all of the human cells and debris it has in it.
 

gl69m

Member
Post #24 (from original thread, from gl69m)
Post #24


Okay, now to correct some minor things, one I got wrong the other I was unsure of.

From post #19,


Quote:



159415eb2f5343688b.png

Right now, I'm not sure that the control line can really rule out a “false positive” of say cross reaction with antibodies developed from infections from other coronaviruses (particularly the ones identified with common colds). It seems that if the control line does not show up, either there is no capture antibodies (goat anti-rabbit IgG) bound to the strip at the C line or would indicate that there might not be any or enough rabbit IgG-gold conjugate on the sample well membrane pad. If the latter was the case (no rabbit IgG-gold), how exactly would any of the lines C, G or M) develop at all? If the former (no capture goat anti-rabbit IgG) this would seemingly only affect the C (control) line anyway and the G and M lines could still develop if they had the capture antibodies on these lines.

Okay, the one thing I was getting wrong here was that the rabbit IgG-gold conjugate is not involved in producing the color in the G and M test lines at all. That is provided strictly by the 'SARS-CoV-2' recombinant antigens conjugated with colloidal gold (SARS-CoV-2 conjugates). Seemingly I guess, no other substrate-enzyme system seems to be involved in producing the burgundy colored lines, just the colloidal gold- conjugated to the SARS antigen and to the rabbit IgG.

This document can help explain that it is the total number of gold particles accumulated on the conjugated antigen or antibody that allows the visible naked eye visualization.

Designs, formats and applications of lateral flow assay: A literature review
November 2015


Quote:



4.1. Gold nanoparticles

Quote:




Colloidal gold nanoparticles are the most commonly used labels in LFA. Colloidal gold is inert and gives very perfect spherical particles. These particles have very high affinity toward biomolecules and can be easily functionalized. Optical properties of gold nanoparticles are dependent on size and shape. Size of particles can be tuned by use of suitable chemical additives. Their unique features include environment friendly preparation, high affinity toward proteins and biomolecules, enhanced stability, exceptionally higher values for charge transfer and good optical signaling [37]. Optical properties of gold nanoparticle enhance sensitivity of analysis in LFA [38]. Sensitivity is a function of molar absorption coefficient and accumulation of gold nanoparticles on target molecule [13]. Optical signal of gold nanoparticles in colorimetric LFA can be amplified by deposition of silver, gold nanoparticles and enzymes [39], [40], [41].

(So this section gives some detection limits for gold nanoparticles)

Analyte
Label
Sample type
Detection Limit
Time of detection
Ref.

Ramos cells
Gold Nanoparticles
Blood
800 Ramos cells
15 min
[82]

Clenbuterol
Gold Nanoparticles
Urine
0.1 ng/mL
10 min
[127]

Aflatoxin B(1)
Gold nanoparticles
Pig feed
5 μg/kg
10 min
[129]

T-2 toxins
Gold nanoparticles
Wheat and oat
100 μg/kg
4 min
[130]

Salmonella enteritidis
Gold nanoparticles
10 CFU
[97]

So it looks like the Aflotoxin assay may be the most sensetive as in needing fewer nanogold particles bound (by mass, in nanograms {ng}, I think) to visualize a line compared to Clenbuterol or T-2 toxins, depending on the amount of sample needed pi-petted onto the kit I suppose. And accordingly the sensitivity detection limit is more sensitive or lower for Salmonella (only 10 cells or cfu) compared to the number of Ramos cells needed (800 cells) to visualize a line.
Second minor correction, from post #19,


Quote:



Now I will cover the section “Main causes of non-specific reactions” from my background information site (https://ruo.mbl.co.jp/bio/e/support/...-reaction.html). I will note that none of these “non specific reactions” or causes of false positives cover cross reactions of non-specific antibodies present in the specimen samples, except heterophilic antibodies (the rheumatoid factors I am not sure from this what their interference is) but this is not a reaction where those antibodies actually bind to the antigen (immunogen) itself but to a capture antibody Fab non antigen binding region (such as the anti human IgG capture antibody on the C and M lines of the pad of the Cellex kit strip). I will illustrate what I mean after pasting this sectional explanations:

Rheumatoid factors

Human blood may contain antibodies that react with human antibodies. A well-known example is autoantibodies commonly found in patients with rheumatoid arthritis. They are typically IgM-type immunoglobulins specific for the Fc fragment of human IgG and called rheumatoid factors (RFs).

nonspe-RF.png


All I really missed was that the center of the large IgM 5 pronged antibody molecular complex (which would appear to have 5 Fc antibody {like IgG style} segments all pointing toward the center), it's the center portion of the IgM molecule that thus binds to the Fc portion of another capture antibody that would be bound on the memberane. I suppose IgMs can also bind to the Fab portions of some other antibodies also.


Got those corrections out of the way, now let us examine changes to the Cellex kit pdf document.


Looking back at post #19 and #18 and the Cellex kit pdf, I noticed that this document has indeed been updated and is not the same as it was when I made post #19. I was thinking about the wording in the kit Composition that I thought about later that was throwing me off, here it is from post #18:


Quote:



says it has “Monoclonal Anti-SARS-CoV-2 antigen conjugated on the membrane.”


Now normally I would think of the wording “anti-” in front of another antigen molecule indicates in tests like these that this should be an antibody. Notice it says on the first page just below the first kit illustration below Test Principle,


Quote:



The anti-SARS-CoV-2 virus IgG, if present in the specimen, will bind to the SARS-CoV-2 conjugates.

This is the same wording it had in that section before and now too for that section on the later document. Now however this is what it states for this molecular component in the kit on the pdf now for the Composition section,


Quote:



Composition Conjugate Pad SARS-CoV-2 antigen coated gold particles

That is not the same wording as this- ““Monoclonal Anti-SARS-CoV-2 antigen conjugated on the membrane.”. “monoclonal” would also usually indicate it is an antibody, unless the word anti- is not in front of the antigen name. It also does not even indicate that it has nanogold coated or conjugated to it. Does this mean that the previous wording actually means that the kit membrane (in the sample well) actually has (or now only had?) the very antibody already on the pad that the test is supposed to be looking for in a blood sample??!! Could the rigging for a false positive in this kit really be that simple?


I wouldn't really think so, surly they were not aiming for 100% positive results were they? I wouldn't think they would rig it that completely, so that's why when I made post #19 that thought came to my mind briefly, but I dismissed it because I thought it just couldn't be that blatant, didn't want to come out sounding accusatory to that kind of degree. But maybe it is??

And further, to reiterate, all of these protein antigens are produced via plasmids (recombinant) in host culture cells (bacteria, yeast, animal or human) grown in flasks or special more flat looking cell culturing vessels for mammalian cells. And such antigen (proteins) can obviously be produced from designer DNA/RNA printed by artificial means and never having had to come from a real organism or virus at all, or a virus that may have never seen the outside of secret military lab before.


Well I doubt that the rigging will be that blatant now, and perhaps it was an error, previously, a typo. Obviously I can't really know for sure. But the thought occurred to me last few days that maybe some kits sent out were actually rigged that way, for instance, like whatever kits the President from Tanzania had tested with blind samples from non-human sources.

Tanzania Suspends Medical Chief After Leader Queries Virus Data

5/4/2020

Tansania testet Motoröl, Pflanzen und diverse Tiere auf Corona. Mit erstaunlichen Ergebnissen

May 7, 2020


I had the thought that kits shipped to other countries (especially targeted countries) may well be rigged in such a way, but a few samples did test negative so they are can't really be rigged for 100% positive, but probably most of them. Among the non-human samples they used were:

using President John Magufuli's words, some paraphrased, and his speech after naming the samples, is very very powerful, and gets to the heart, the crux of why people, everywhere, need to be very very wary and skeptical of everything we are presented with, with this 'covid-19'.


Quote:



We took car oil (we named it Jabil Hamza, 30 years old male) results were negative

Quote:




We took samples from the Jackfruit (Durian, we named it Sarah Samual 45 years old female) results were inconclusive

We took samples from the PawPaw (fruit) (we named it Elizabeth Ane, 26 years old female) results were positive, that it had corona. That means the liquid from the PawPaw is positive

We took samples from (a bird type) called Kware, results were positive

We took samples from a rabbit, results came back undeterminent

We took samples from a goat and the results came back positive

We took samples from a sheep and it came back negative

And so on and so on. So now when you see this you have taken samples and say they are human's and the results came back positive, that they have corona; that means all the PawPaws should be in isolation also. And when you take a goat's samples and they are also positive, that means all the goats that we have here by assumption, or maybe the goat with the sample which was taken should also be in isolation.

So when you notice something like this, you must know there is a dirty game played in these tests. That there unbelievable things happening in this country. Either the laboratory workers in there are bought by people with money, either they are not well educated which isn't true because this laboratory is used for other diseases. Either the samples which are brought in, because even the reagents are imported, because even the swabs are also imported. So it's a must that something is actually going on. Now even the PawPaws samples are positive, they have corona. So WHO should really do something big about these things, and even the goats have corona. And if they haven't realized that the corona effects humans or goats and it also affects trees. So scientists haven't done research on this matter.

So there several people through the extra information I have here, there must be people who were told they are positive, while they are not really corona patients. And some might even die from worry. The pawpaw, it's there it's not dead, it's there just getting ripe. And the goat is also just around, it's not even dead. The jackfruit (durian) it's there and maybe it will just rot after it has reached it's time. But all those are positive and more other things.
So I am giving advise to Tanzanians, don't worry, and for those who aren't tired and not injured in anyway, why should you worry? The flu has always been there, this is just more advanced, this shall also pass.

But the issue of finding out even a pawpaw has corona, it's inside the pawpaw not it's outer layer. They would have said it's someone who touched it has corona. But they took the samples with the right specifications, they inserted the swab inside the pawpaw. They might say someone went inside the goat and gave it corona. But to (have all these with) corona, there must be several questions to ask ourselves, we as Tanzanians, but also the whole world and Africa at large, we must ask ourselves about this whole issue of the virus. There must be something that isn't understood well by Tanzanians, and to the science community, and it might not be understood by the whole world.

But I am giving advise to the one who are using these equipments, especially in Africa, take samples from different animals, take samples of anything even a wall, even a lizard. Take a sample of anything, they are going to prove all that I am saying. I am a science expert I know what I am saying. And this work was done by people who are really qualified. I am urging Tanzanians, we are still in the elementary stage let's not panic. Let's continue to work hard, production should continue and in a huge scale. We should not put fear on each other, and politicians should stop using this as an agenda, it's not going to help them. But Tanzanians should not accept to be used, corona is not in Tanzania only, it's everywhere, it's in the United States of America, England, Holland, Sweden, everywhere, Japan, China...

Now they should not use this as a base, first of all this disease never started here, Tanzanians let's stand strong, let's unite, let's put god first, let's work hard. We should not be afraid of each other, we should help each other, so we can solve this problem together. And for those who are trying to do nonsense things, like the things I just said, that even a pawpaw has corona, Kware (type of bird) has corona, a goat has corona.

In the scientific approach people really have to work hard, I am asking our specialist, in universities, Sokoine (university), university of Dar es Salaam, all universities NEMRI and others, right time to work really hard, show your integrity in the research, during this period. I'm not really sure about the head of this laboratory, if he really knows, because even when we were taking the samples, we didn't tell him. He tested the samples thinking they are samples from humans. Why didn't he do trials? In the initial days? So he can justify the test kits he was using. So there are so many nonsense things in all this. (end video)

Now why in the hell don't we have a President like the President of Tanzania John Magufuli? This is what a real President that seriously cares about his own country would have done when presented with the “pandemic' storyline of something like 'covid-19'. Unfortunately though it's a damn shame that we have a POTUS that knows it's all a “LIVE EXERCISE” because his cabinet Secretary of State told him and all of us so; and likely that they (Team Trump) all have known this all along!! Fucking goddamn shameful and disgraceful!!! Disgusting beyond words.

I tell you, if this man John Magufuli were American and running for President in 2020, he sure as hell would be guaranteed my vote; I would actually bother voting for a candidate like him even though I have really given up on voting since like the 2008 election.


Here is fake liberal NPR using the words of a controlled puppet no doubt to say Magufuli is lying, and of course to promote balony coronie paradigm, and promote extreme detriment to Tanzania obviously (as well as all other countries in the "developing" world)



Quote:



PERALTA: He said he had samples taken from a goat and a sheep and a bird and a papaya and had them labeled with human names. They were sent to Tanzania's National Laboratory.

Quote:




(SOUNDBITE OF ARCHIVED RECORDING)

MAGUFULI: (Speaking Swahili).

PERALTA: The papaya and others tested positive, he claimed - proof his labs were falsifying positive test results to sabotage Tanzania. He went on to say that he had ordered an herbal cure being pushed by the president of Madagascar.

ZITTO KABWE: I think the president is lying, and it is a very dangerous lie.

PERALTA: That is Zitto Kabwe, one of Tanzania's most prominent opposition figures. He says doctors and nurses unions are secretly keeping their own count of COVID-19 cases, and they have told him the cases are seven times more than what the government is reporting.
KABWE: What I can say is that the president is in a panic.

, so-called liberal non-racist piece of shit NPR, this shows how much they care about countries in Africa, or South America, Asia or anywhere else for that matter. NPR sucks as bad as the Heritage Foundation, or likely NPR is really in their back pocket anyway.

From the video description, translation from German,


Quote:



There are great doubts about the international approach and it is also criticized or assumed that the test sticks are already delivered contaminated in order to produce incorrect results.

Quote:



You will surely remember that test systems in which this RNA was already included were sent to the UK in March.

Some other articles of this incident said that the kits were imported from China. So far haven't seen what kits or company they are from, that would be helpful. But I am wondering that these kits might be for the PCR testing and not the antibody testing, but without further information we won't know.

But if we remember that in the PCR test protocol from the CDC, that a Human Specimen Control (HSC) needs to be ran,

from my post #5


Quote:



Quote:
Human Specimen Control (HSC)
Description
Manufactured by CDC. For use as an RNA extraction procedural control to demonstrate successful recovery of RNA as well as extraction reagent integrity. The HSC consists of noninfectious (beta-Propiolactone treated) cultured human cell material supplied as a liquid suspended in 0.01 M PBS at pH 7.2-7.4.


11- Possible bias,

On page 13 it says that the HSC (Human Specimen Control) is not provided, but that the HSC “must be extracted and processed with each specimen extraction run.”
HSC, this control is defined as- “For use as an RNA extraction procedural control to demonstrate successful recovery of RNA as well as extraction reagent integrity.”

I guess it can be obtained in other kits or use alternatives. Skipping a little ahead though, on page 18, in the protocol directions step 8 (and stated under the plate diagram {figure 2} for setup of samples), that the user can replace sample 10 (specimen sample, S10, in the row 11 wells) with HSC, “if necessary”. I would think that implies that you can exclude this control sample if deemed “unnecessary” by the testing lab?.

And so if the HSC can be excluded from the test (setup, not sure about that right now), than this would also be another bias, against checking the performance of the lysis buffer (RNA extraction from the samples/specimens), for the HSC should detect DNA (by the primer/probes for) from the human Rnase gene (RP) as well as the positive 2019-nCoV controls (has Rnase primers included with N1 & N2) should detect RP.


(bias) 14-
Quote:
I
Quote:
f the RP assay does not produce a positive result for human clinical specimens, interpret as follows: −If the 2019-nCoV N1 and N2are positive even in the absence of a positive RP, the result should be considered valid. It is possible, that some samples may fail to exhibit RNase P growth curves due to low cell numbers in the original clinical sample. Anegative RP signal does not preclude the presence of 2019-nCoV virus RNA in a clinical specimen.
This bias is carried even further as a bias against a “negative” result,
Quote:
If all 2019-nCoV markers AND RNase P are negative for the specimen, the result should be considered invalid for the specimen.If residual specimen is available, repeat the extraction procedure and repeat the test. If all markers remain negative after re-test, report the results as invalid and a new specimen should be collected if possible.
This is basically a double whammy in these cases, if there is a problem with the RP detection. This is a control primer to insure that RNA has been successfully extracted and particularly from human cells. Extraction is necessary also to extract any viral RNA from the cells or at least separate it from cellular debris/material enough to allow amplification in the PCR thermal cycling reactions.

So, like I was saying, the HSC is a very important “control” in this test, for at the minimum it should tell us that the sample came from a human, and not a goat, sheep, pawpaw, jackfruit, or even car oil, but however it could not tell us what person it actually came from by detecting the human RP gene RNA in and of itself.


So now I have seen the change in the Cellex kit pdf document, 2 changes, and here is the first change,


Quote:



(first version, from post #19, posted April 29, 2020)

Quote:




TEST PRINCIPLE

The Cellex qSARS-CoV-2 IgG/IgM Rapid Test is a lateral flow chromatographic immunoassay which can detect antibodies against the SARS-CoV-2 virus. The test cassette consists of: 1) a burgundy colored conjugate pad containing SARS-CoV-2 recombinant antigens conjugated with colloidal gold (SARS-CoV-2 conjugates) and rabbit IgG-gold conjugates; 2) a nitrocellulose membrane strip containing an IgG line (G Line) coated with anti-human IgG, an IgM line (M Line) coated with anti-human IgM, and the control line (C Line) coated with goat anti-rabbit IgG.

(second version from clicking today)

TEST PRINCIPLE

The Cellex qSARS-CoV-2 IgG/IgM Rapid Test is a lateral flow chromatographic immunoassay which can detect antibodies against the SARS-CoV-2 virus. The test cassette consists of: 1) a burgundy colored conjugate pad containing SARS-CoV-2 recombinant antigens (S and N proteins) conjugated with colloidal gold (SARS-CoV-2 conjugates) and rabbit IgG-gold conjugates; 2) a nitrocellulose membrane strip containing an IgG line (G Line) coated with anti-human IgG, an IgM line (M Line) coated with anti-human IgM, and the control line (C Line) coated with goat anti-rabbit IgG.

So the first document does not state what the 'SARS-CoV-2' antigens in the kit are, while the second document does tell us the antigens (S and N proteins).

I actually had the previous document downloaded on my phone, cause I didn't have every part of it copy/pasted in post #18 or #19, and only had the one snippet from the previous Cellex pdf here of part of the Composition listing- “Monoclonal Anti-SARS-CoV-2 antigen conjugated on the membrane.”, so I am glad I still had the pdf. So I e-mailed it to myself from the phone (I have to do this with photos too cause I don't have a damn chord that will down load it directly to the PC) and from e-mail on the PC download it.


So here is the second change in the Cellex pdf from the previous version to the version now,


Quote:



(first version, post #19 {with posted snippet}, posted April 29, 2020)

Composition

Conjugate Pad Monoclonal Anti-SARS-CoV-2 antigen conjugated on the membrane.
G Line Anti-human IgG
M Line Anti-human IgM
C Line Goat anti-rabbit IgG
Sample Buffer 0.01M PBS; PH 7.4
Negative Control Negative human serum, chemically inactivated.
Positive Control Negative human serum spiked with positive serum, chemically inactivated. It may be reactive to the IgM line, IgG line or both.

(second version from clicking today)

Composition

Conjugate Pad SARS-CoV-2 antigen coated gold particles
G Line Anti-human IgG
M Line Anti-human IgM
C Line Goat anti-rabbit IgG
Sample Buffer0.01M PBS; PH 7.4
Negative Control Negative human serum, chemically inactivated.
Positive Control Negative human serum spiked with positive serum, chemically inactivated. It may be reactive to the IgM line, IgG line or both.

We can clearly see there is a difference in these two items from the previous document to the later version.


But wait, the second document has 5 pages while the first one has 4 pages, so there is a third change to it, let's see what that is,


Quote:



CONDITIONS OF AUTHORIZATION FOR LABORATORIES

The Cellex qSARS-CoV-2 IgG/IgM Rapid Test Letter of Authorization, along with the authorized Fact Sheet for Healthcare Providers, the authorized Fact Sheet for Patients, and authorized labeling are available on the FDA website: https://www.fda.gov/medical-devices/...ons#covid19ivd.

However, to assist clinical laboratories using the (“your product” in the conditions below), the relevant Conditions of Authorization are listed below:

A. Authorized laboratories1 using your product will include with result reports of your product, all authorized Fact Sheets. Under exigent circumstances, other appropriate methods for disseminating these Fact Sheets may be used, which may include mass media.

B. Authorized laboratories using your product will use your product as outlined in the Instructions for Use. Deviations from the authorized procedures, including the authorized instruments, authorized clinical specimen types, authorized control materials, authorized other ancillary reagents and authorized materials required to use your product are not permitted.

C. Authorized laboratories that receive your product will notify the relevant public health authorities of their intent to run your product prior to initiating testing.

D. Authorized laboratories using your product will have a process in place for reporting test results to healthcare providers and relevant public health authorities, as appropriate.

E. Authorized laboratories will collect information on the performance of your product and report to DMD/OHT7-OIR/OPEQ/CDRH (via email: CDRH-EUA-Reporting@fda.hhs.gov) and You (tech@cellex.us) any suspected occurrence of false positive or false negative results and significant deviations from the established performance characteristics of your product of which they become aware.

F. All laboratory personnel using your product must be appropriately trained in immunochromatographic techniques and use appropriate laboratory and personal protective equipment when handling this kit, and use your product in accordance with the authorized labeling. All laboratory personnel using the assay must also be trained in and be familiar with the interpretation of results of the product.

G. Cellex Inc., authorized distributors, and authorized laboratories using your product will ensure that any records associated with this EUA are maintained until otherwise notified by FDA. Such records will be made available to FDA for inspection upon request.

1 The letter of authorization refers to, “Laboratories certified under the Clinical Laboratory Improvement Amendments of 1988 (CLIA), 42 U.S.C. §263a, to perform moderate and high complexity tests” as “authorized laboratories.

”INQUIRIES AND GENERAL INFORMATION

Please visit website www.cellexcovid.com

I noticed that the pdf had changed on Monday (5/11/20), so in less than two weeks the document had been changed, I have to wonder if someone at Cellex had caught the Anti-SARS-CoV-2 antigen on the Composition list, and obviously needed to change that before the kits start to become disseminated to the “point of care” (POC) users. Surly they will claim it to be a typo, oh those crazy conspiracy theorists, they never allow for legitimate unintentional human error of course.


Another interesting aspect of naming the antigens used that are named in the newer pdf version (the S {spike}and N {nucleocapsid I believe} proteins), is that I have seen it reported in recent articles (from March 2020) that there are at least two sub-units to the S protein, S1 and S2. It is now claimed that the ACE2 receptor binding properties of the RBD (receptor binding domain) for 'sars-cov-2' which the earlier paper I had looked at showed 5 out of 6 amino acid residues differed from the RBD of sars-cov: and that this RBD is significantly different from other coronaviruses (common cold ones).

And so that using the S1 sub-unit should yield higher specificity and lower cross reactivity than using the entire S protein, since the S2 sub-unit is thus much more highly conserved across the coronavirus panel (the different specie/strain used in testing for cross reactivity), and should at least nominally produce some cross reactivity although it will likely be claimed to be weak, but with these kits, there may be ways to make that non-specificity stronger, depending on how the components are bound to the membrane in the sample well or by spiking very small amounts of interfering substances to increase the cross-reaction etc.

The N protein is about 90% conserved between sars-cov and 'sars-cov-2' (genome/protein analysis), and so cross reactivity between these two is expected, but N protein is not as well conserved for other coronaviruses compares to 'sars-cov-2' so cross reaction may be weaker with the other coronaviruses of course. But it is also claimed that sars-cov no longer exists in any population today, but I have to wonder is that truthful or not, I suspect definitely not, but never mind proving that right now:

but here is one source that claims to be developing a 'sars-cov-2' treatment (and vaccine possibly I think) from antibodies produced from the sars-cov virus:


Quote:



This company working on a Covid-19 treatment involving SARS antibodies

Quote:




Distributed Bio is creating a treatment for Covid-19 patients using antibodies from SARS patients. Jake Glanville, Distributed Bio CEO and founder, joins ‘Closing Bell’ to discuss the antibody treatment.
Tue, Apr 21 20203:51 PM EST

(from my Facebook post, April 24, 2020, describing what Jake Glanville was saying in the video)

SARS antibodies (from original SARS outbreak virus 2002-2004) being manufactured in biotech (probably 600 gallon vats) companies, to 'treat' 'covid-19', supposedly from 'covid-19' recovered patients. If these antibodies can "treat' 'covid-19', is "covid-19" really just another actual SARS outbreak? It should be questioned whether or not exposure to SARS virus (SARS-CoV-1) or other known strains of previously known coronaviruses (like strains 229E, OC43, HKU1, NL63 that cause "common colds") cam cause false positives on the new 'covid-19' antibody serum tests, I would likely believe that they do absolutely, but will be claimed to be much more specific (higher %) than they really are.

(corrected comment on the post, posted later)

I need to correct my original comment on this story/video, they are using direct antibodies produced against the original SARS virus (that part is probably true) and not using antibodies from 'covid-19' "recovered' patients, and they claim to have mutated the SARS antibodies hundreds of millions of times (this is most likely a total lie) and are beginning to produce trial batches of said antibody protiens now.
So if some companies are allegedly trying to use so-called “convalescent” plasma from recovered 'covid-19' patients to attempt treatments (primarily from any virus “neutralizing” antibodies these people have supposedly produced), why would anyone really need to use anti-sars-cov antibodies for that? I have seen studies suggesting that antibodies to sars-cov can be used for serology testing of 'sars-cov-2' and possibly for “viral neutralization” as well, not bothering to post those sources at the moment:

but we could also ask why if that is true- than why bother having to mutate the sars-cov antibodies hundreds of millions of times in order for them to then be able to recognize-bind to 'sars-cov-2' for treatment (or perhaps serology as well?)??? I believe I smell total bullshit there on the part of Jake Glanville and Distributed Bio.


So one last thing I wanted to add to this massive post, is a diagram I drew to represent possible hypothetical results on the Cellex qSARS-CoV-2 IgG/IgM Rapid Test kit, first result would be considered a "true positive" if we assume a sample (blood say) actually has an antibody that can bind to the 'sars-cov-2' antigen in the test kit (the two antibodies depicted with blue color, IgG and the larger 5 prong IgM):
and the second result would be a "false positive" if an antibody in the blood sample is one produced from say the NL-63 coronavirus strain- a current or previous exposure/infection (the two antibodies depicted in green color, and the IgM one I labeled wrong in my drawing {of course I would
biggrin.gif
, not fixing the image now}, it should read (H anti-NL-63 IgM) and not (H anti-SARS IgM));
That's it for now, hope those that enjoy long posts really like this one
biggrin.gif
more than I enjoyed typing it, didn't think I was ever going to finish this one, sheesh!
 

alpha77

Member
Was very surprised to find at German WIKI a critical review for PCR:

"Positive PCR-Testergebnisse wurden von 2020 bis 2021 in der Regel als Indikator für eine Infektion betrachtet, die auch symptomlos, asymptomatisch oder präsymptomatisch verlaufen, dabei aber infektös sein konnte. Bei den PCR-Tests war der Ct-Wert ein Richtwert für die Ansteckungsgefahr. PCR-Tests waren jedoch nicht normiert und standardisiert. Die Ct-Werte wurden nicht immer weitergemeldet (anderslautende Angaben von Karl Lauterbach). Die Ergebnisse sind zudem abhängig von der Methodik der Entnahme, der Menge der Probenentnahme, dem Zeitpunkt der Entnahme im möglichen Infektionsverlauf, von der Patientengeschichte und von der Person, die die Probe entnimmt, außerdem werden strenge Laboratoriumsbedingungen vorausgesetzt.

Aus den positiven Testergebnissen wurde die Inzidenz errechnet, die zur Begründung von Lockdown-Maßnahmen diente. Eine Untersuchung vom 31. Mai 2021 soll ergeben haben, dass 78 Prozent der zwischen dem 8. März und dem 10. Mai 2021 positiv Getesteten sehr wahrscheinlich nicht ansteckend gewesen seien, da die Tests in der Stichprobe Ct-Werte über 25 und damit eine niedrige Viruslast anzeigten.[1] Für das RKI gilt ein Ct-Wert größer 30 als Indiz für fehlende Infektiosität.[2]" (WIKI)


Here also a comment found at YT which seems an acurate short summary:

"Alle bisher veröffentlichten Studien (zu SARS-CoV-2) basieren auf der Annahme von Sequenzvorschlägen ( ! ) , welche von chin. Wissenschaftlern ( Zhang et al.) am 03.02.2020 vorgestellt wurden ( von der CD am 04.02.2020 veröffentlicht). Man hatte den kompletten Bronchialauswurf eines Patienten genutzt, OHNE das vorab eine Isolation stattgefunden hatte. Prof. Zhang schreibt selbst, dass er von kurzen Genabschnitten ( von etwa 25-30 Nukleotiden) mit – Zitat „sehr aufwendigen Methoden“ ein Genom von 29803 Nukleotiden ERRECHNET hatte. Einfach ausgedrückt – aus 0,1% mach 100%."
 

gl69m

Member
@alpha77 (post #13)
Was very surprised to find at German WIKI a critical review for PCR:

Thanks for that, most interesting part for me was this (english translation via google translator),
The incidence used to justify lockdown measures was calculated from the positive test results. A study on May 31, 2021 is said to have shown that 78 percent of those who tested positive between March 8 and May 10, 2021 were very likely not contagious, as the tests in the sample had Ct values above 25 and thus a low one Indicated viral load. [1] For the RKI, a Ct value greater than 30 is an indication of a lack of infectivity. [2] "(WIKI)
I believe Ct means cycle threshold, the number of cycles ran at which the fluorescent detector picks up signal from the reporter dyes in the pcr reaction wells, meaning that enough DNA has been amplified to detect a minimum signal. I assume they mean that at Ct (amplification cycle) 25 and above means very few copies of original DNA in the sample was initially present, therefore taking that many cycles before the machine sensor could detect a fluorescent light signal back from the sample above the background noise signal level. Anything above 30 cycles, I think they are saying that there was way too few to start with (less than 10 original copies perhaps? not sure) to be of any concern in infectivity aka so-called viral load. The higher the number of cycles the more likely a non-specific binding can occur with one of the primers and can trigger DNA amplification and thus potentially that can begin at any cycle and eventually produce a signal, which would be a false positive since it would be amplifying a gene that wasn't the intended gene target. The Ct cycles ran back in 2020 were at least 35 cycles and often at 40 and above if I recall correctly. There are other ways the primers can generate enough signal on their own to create false positives too.
 

alpha77

Member
Plandemic/C19 is a fucking lame hoax, only cause 90%+ people still comply and believe the crap gives it a life, technicaly it is long dead and burried.. I mean believe the "experts" media and "politicians" it is beyond me, when these people lied so much in the past and most of the public still buys it...:mad: These people are to blame who get the vx, make tests (without tests no pandemic) and even blame people that are awaken to the BS - 9/11was Kindergarten compared to this and still you cannot escape the propaganda everywhere in the nets and newspapersit is still everyday even if one does not watch TV or read MSM. I am pissed and wish was in the US where you can buy weapons to have at least a last line of defense, but seems the resistance in the US is also not much bigger than in Europe ???? I thought the partiots say do not tread on me etc....
 

gl69m

Member
@alpha77 (post #15)
I am pissed and wish was in the US where you can buy weapons to have at least a last line of defense, but seems the resistance in the US is also not much bigger than in Europe ???? I thought the partiots say do not tread on me etc....

Yeah I find that odd that I haven't seen any preppers or conservative militia types really come out and say that 'covid' is a complete hoax, they seemed to still buy into it as real and downplay it of course, but they all claim that they know treatments and cures the medical industry suppresses etc. The whole thing boggled my mind last year (but shouldn't have been surprising I guess) that all the protesting going on was almost all centered around the political shoving match of right vs left, for the last several decades, and very very little about protesting 'covid' restrictions et al; which there is plenty to protest from both sides against 'covid', but I would have expected a lot more of that from the conservative side especially from the self proclaimed patriots... disappointing really. This year there is now considerably more protest against restrictions and vaxxine passports and requirements/mandates, worldwide, and that is encouraging, Australia needs that up the wazoo, very little such protesting in the U.S. unfortunately but has picked up a little bit of steam as 2021 has rolled along.
 

gl69m

Member
Post #25 (from original thread, from gl69m)
Post #25


Saw this site on my Facebook feed for 'covid-19' testing,

ION Drug and Alcohol Testing
https://iondat.com/covid19


Quote:



Covid 19 IgG Testing
Who is this test for?

This test is for anyone who has NO current symptoms and has had NO symptoms for 10 days.
What does this test do?

This test determines if you have IgG antibodies to COVID-19. The human body produces IgG antibodies as part of the immune response to the virus. It usually takes 10 to 18 days to produce enough antibodies to be detected in the blood.

Antibodies typically suggest protective immunity after recovering from or being exposed to COVID-19. Evidence is still being collected to determine if the IgG antibodies provide protective immunity against SARS COV 2, the virus that causes COVID 19.
Does taking this test help others?

Allowing us to share your results will help our health officials better understand the virus.
The IgG Serology Test

The IgG serology test has not been reviewed or approved by the FDA. The test is authorized to be performed and marketed by the FDA.

Results from the antibody test should not be used as the sole basis to diagnose or rule out SARS-COV-2 infection or to inform infection status. Only an RT-PCR molecular diagnostic test which tests for the actual virus can diagnose the disease.

Negative results do not rule out SARS-COV-2 infection, particularly in those that have been in contact with the virus. Follow up testing with a molecular diagnostic should be considered to rule out infection in these individuals.

Positive results may be due to past or present infection with non-SARS-COV-2 corona virus strains, such as corona virus HKU1, NL63, OC43, or 229E.



Is it safe to come to a ION Testing Location?

ION Testing Services takes your safety and health seriously and has procedures in place to protect both our clients and our employees.

We require all clients and employees to wear masks.

When you enter our facility you will be asked to cleanse your hands with hand sanitizer. Then we will take your temperature with a non-contact thermometer, We clean and sanitize our facility to the highest standards. We can get you in and out within 10-15 minutes.

If you prefer staying in your car until your appointment, just call us when you arrive and we will text you when it is time to come in. We are located at 220 West Brandon Blvd. Suite 209 Brandon, FL 33511. 813-448-2870
:


Talk about a disclaimer!! One leading to a very high number of false positives, depending on whatever "antigen' the test kit they are using, how "specific" for the alleged 'sars-cov-2' "antigens' used as opposed to what someones current blood antibodies were really produced from that might bind the 'antigen" in the test kit. Unfortunately few will probably even read the whole page or comprehend that line even if they do read it, as illustrated by the FB post I saw, a woman asked about where to go for testing, and another woman commented and pointed out that line about false positives from other coronaviruses and told that woman not to waste her money, no response from her (woman asking where to go for testing) though as per usual.

Notice too the image of the punctured finger, with a lance pen tool like used for blood glucose testing in diabetics, we saw in the Cellex kit that this type of blood is not recommended ("Use with fingerstick blood is not recommended.") for use in their kit. I don't know about the other kits though, not sure how many recommend fingerstick blood or not right now.
 

gl69m

Member
Post #26 (from original thread, from Truthissweet)
Post #26 (from Truthissweet)


From gl69m:


Quote:



This test is for anyone who has NO current symptoms and has had NO symptoms for 10 days.
What does this test do?

This test determines if you have IgG antibodies to COVID-19. The human body produces IgG antibodies as part of the immune response to the virus. It usually takes 10 to 18 days to produce enough antibodies to be detected in the blood.

Let's say I have really good antibodies. Top of the line type stuff. Can I sell the antibodies to use in a vaccine? Can govt force me to "donate" antibodies for the good of mankind?

Post #27 (from original thread, from gl69m)
from Truthissweet (post #26),


Quote:



From gl69m:
Quote:
This test is for anyone who has NO current symptoms and has had NO symptoms for 10 days.
What does this test do?

This test determines if you have IgG antibodies to COVID-19. The human body produces IgG antibodies as part of the immune response to the virus. It usually takes 10 to 18 days to produce enough antibodies to be detected in the blood.]

Let's say I have really good antibodies. Top of the line type stuff. Can I sell the antibodies to use in a vaccine? Can govt force me to "donate" antibodies for the good of mankind?

Great question Rob, I wouldn't doubt at all that eventually we will hear stories like this as the psyop progresses, I'll have to look into it. I found one paper from China where they purportedly used donated plasma (from donated blood, termed "convalescent plasma treatment") of 'covid' "recovered' patients to treat other 'covid' patients, and claimed good success rate, I will have to catch up on that later; I know I say that a lot and many times I never come back to something, my fault, but I try to look into too many things, and I'm not good at finishing or following up on multi-tasking like that, too much work
biggrin.gif
.

Hopefully I am contributing useful information and worthwhile breakdown of so that what I add can add to the collective understanding of what's going on that all of us as a whole have contributed.
 

gl69m

Member
Post #28 (from original thread, from gl69m)
Post #28


Dr. Pam Popper (she may be an alternative health doctor not really sure) explains 'covid-19' testing innacuracies, and that Dr. Joseph Fair claimed he must have had 'covid' but he tested "negative" for it (PCR test I believe) 4 times.

Misinformation, Inaccurate Tests and What’s Next
Jun 4, 2020







She explains very well the extreme bias in 'diagnosing' a "presumptive positive" 'covid' case clinically when the "diagnostic' test actually comes back negative.

NBC News contributor with ties to New Orleans is fighting coronavirus, report says
May 14, 2020
https://www.nola.com/news/coronaviru...08fe98bb3.html


Quote:



5ebdcc6e9c12a.image.png

A doctor who has contributed to NBC News' coronavirus coverage and has ties to New Orleans is recovering from the infectious disease himself, according to a report from the news organization.

Dr. Joseph Fair, a 42-year-old virologist and epidemiologist, popped into Thursday's third hour of the 'Today Show' to detail his COVID-19 battle, which he said he believes he contracted about three days after a crowded flight to his home in New Orleans.

Fair told show host Al Roker he believes he contracted the disease through his eyes.

"I had a mask on, I had gloves on, I did my normal wipes routine ... but obviously, you can still get it through your eyes," Fair said during a video call from his hospital bed. "... we tend to pay attention to the nose and mouth because that is the most common route, but you know, droplets landing on your eyes are just as infectious."

After several days of fighting off the disease, Fair was downgraded from critical condition on Wednesday. He said he initially didn't go to the hospital in an effort to not overwhelm the system as he only had flu-like symptoms that started with a loss of appetite. Eventually, he called an ambulance once he said he could only take in 25 percent of the oxygen he was trying to breathe.

Fair told NBC News that he tested negative for COVID-19 four times, but said that's not surprising since he waited a while to go to the hospital.
He also left a message for others like him, considered young and at "the peak of health" in their lives: "If it can take me down it can take anybody down."

You can read more about Fair's diagnosis and recovery here.

There is video of Dr. Fair describing his bout with 'coronavirus', I only watched about 20 seconds of it, IMSO complete crisis acting by Dr. Fair, he might have had a sore throat. If more people don't start see this murderous hoax for what it is and stay far away from this bullshit testing (of all kinds), we are in for a world of hurt coming in this society.
 
Top