Smoking guns that prove 'COVID-19' is a planned psyop and simulated pandemic

Sinister Dick Cheney

Active member

HOW TO TELL THE DIFFERENCE BETWEEN THE DEATH SHOT AND WHAT THE GOVERNMENT / ELITES / JEWS GET.

The "Elite" shot is cloudy off white. The death jab is clear yellow.

THIS IS THE DEATH SHOT FOR THE MASSES.

pfizeryellow.jpg


The jab the elites/government/Jews get is off white:

offwhitepfizer.jpg


The off white vial above is obviously what Pelosi got.

pelosivax.jpg


Now look at the instructions for mixing the Pfizer vax. If it is the safe one, it will be off white

offwhite.png


Once again:
The death juice


pfizer2.jpg


What the "elite" get.

offwhitepfizer.jpg

ANY DOUBTS? THEN GO BACK AND READ PFIZER'S DIRECTIONS ON WHAT COLOR THAT SHOT SHOULD BE. IT IS NOT CLEAR YELLOW, IT IS OFF WHITE.

THERE REALLY ARE DIFFERENT FORMULATIONS FOR DIFFERENT PEOPLE, THEY ARE BUSTED.


All we know from this is that there is more than one formulation when all should be identical. There may well be a cloudy white death shot also.
 

gl69m

Member

HOW TO TELL THE DIFFERENCE BETWEEN THE DEATH SHOT AND WHAT THE GOVERNMENT / ELITES / JEWS GET.

The "Elite" shot is cloudy off white. The death jab is clear yellow.

THIS IS THE DEATH SHOT FOR THE MASSES.

pfizeryellow.jpg


The jab the elites/government/Jews get is off white:

offwhitepfizer.jpg


The off white vial above is obviously what Pelosi got.

pelosivax.jpg


Now look at the instructions for mixing the Pfizer vax. If it is the safe one, it will be off white
offwhite.png


Once again:
The death juice


pfizer2.jpg


What the "elite" get.

offwhitepfizer.jpg

ANY DOUBTS? THEN GO BACK AND READ PFIZER'S DIRECTIONS ON WHAT COLOR THAT SHOT SHOULD BE. IT IS NOT CLEAR YELLOW, IT IS OFF WHITE.

THERE REALLY ARE DIFFERENT FORMULATIONS FOR DIFFERENT PEOPLE, THEY ARE BUSTED.


All we know from this is that there is more than one formulation when all should be identical. There may well be a cloudy white death shot also.
@post #101, is there a link to what was presented in this post Dick?
 

gl69m

Member
I posted about this guy on another thread (The Convid vaccine thread (what is purpose of vax and what is in the vax?) plus 5G connection); Barney Graham, and his role in helping to create the Moderna vaxxine, in this article here,

Government-Funded Scientists Laid the Groundwork for Billion-Dollar Vaccines
https://khn.org/news/vaccine-pionee...roundwork-for-billion-dollar-pharma-products/

and I had not initially noticed his name on the bottom right of this slide here from this document, I posted this on the original Let's Roll Forum I think probably sometime around April or May 2020,

NIAID Response to the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)
https://www.hhs.gov/sites/default/files/nvac_feb2020_day1_panel2.pdf
slide 8
1637881200998.png
I noticed Barney Graham's name on this slide maybe a couple months ago probably in September 2021. There is a little bit more (to say the least) to Graham's story as relates to 'covid-19' and vaxxines. Now this may not be smoking gun “evidence” helping to prove hoax/psyop, but I think it is very strong correlative evidence that these vaxxines as well as the 'covid' psyop narrative have long been in the making, and point strongly towards psyop/hoax/fix/scam, a decade ago at least for some key players and much longer for others in the “coronavirus” research arena and vaxxine development.

Here is an article from Graham's alumnus Vanderbilt University singing praises for his efforts in creation of the Moderna spike-vax,
Shot in the Arm: Groundbreaking COVID-19 vaccine research by alumnus Dr. Barney Graham began at Vanderbilt decades ago
https://news.vanderbilt.edu/2021/03...arney-graham-began-at-vanderbilt-decades-ago/
In early May of last year, soon after the United States reported its 1 millionth case of COVID-19 nationwide, Dr. Barney Graham, PhD’91, picked up his ringing phone with equal parts hope and trepidation. As deputy director of the National Institutes of Health’s Vaccine Research Center, Graham knew the call could mean one of two things: a breakthrough that might spare the lives of millions around the globe, or a discouraging setback that would allow the accelerating pandemic to continue unchecked for the foreseeable future.

Two months earlier, Graham had overseen the injection of the first volunteers with an experimental vaccine, developed by biotech company Moderna, to combat the novel coronavirus. The patients’ blood serum had been extracted and flown across the country to Nashville, where it was analyzed in the lab of Dr. Mark Denison, director of the Division of Pediatric Infectious Diseases at Vanderbilt University Medical Center.

Recent scientific advances enabled the Moderna vaccine to be developed in a matter of weeks—as opposed to the years typically required for more traditional vaccines—but this was by no means an overnight success story. The key to unlocking a vaccine for COVID-19 was more than 30 years in the making and based on research into a number of other infectious diseases.

In fact, the Moderna vaccine and a similar vaccine developed by Pfizer, as well as an antibody treatment developed by AstraZeneca and the antiviral drug remdesivir, all have their roots in research conducted by Graham and others at Vanderbilt in the 1990s, when no one spared much money—or thought—for coronaviruses. In the ensuing decades, the passion of many of those researchers came together to create treatments for the COVID-19 pandemic in record time.

Graham did some HIV research too, surprise surprise, and on RSV (Respiratory syncytial virus, a significant childhood respiratory disease), moving on though; his apparent colleague Mark Denison (also an alumni from Vanderbilt) had this to say in the article,
“Barney represented to me the ultimate synthesis of a visionary, brilliant scientist, who is also exceptionally kind, generous and collaborative,” says Denison, another Kansas University grad who arrived at Vanderbilt in 1991 and lived across the street from Graham. “I don’t remember him ever putting down the science of anybody.”

Denison, who now holds the Edward Claiborne Stahlman Chair in Pediatric Physiology and Cell Metabolism and is professor of pathology, microbiology and immunology at Vanderbilt, knows something about pursuing unpopular viruses. He became fascinated with the complex genetic material of coronaviruses—pathogens that cause extreme infections in animals but often only mild colds in humans.

“I’ve heard it a million times—who really cares about coronavirus?” he says. “It was very hard to get the research into high-impact journals because it was not sexy.”

Jason McLellan, another name from the Government-Funded Scientists article and colleague of Graham, is a key player in developing the recombinant “stabilized pre-fusion” corona spike protein,
Having little success with SARS and MERS initially, Graham and McLellan turned to the more common coronavirus HKU1, quickly stabilizing the spike protein in its pre-fusion form by adding two molecules of the amino acid proline—the most rigid of the 20 amino acids—to the top of its central helix. With that stabilized spike, they found they could produce 50 times more spike protein and much better neutralizing antibodies.

Despite the radical implications, Graham and McLellan struggled to get their research published. They were rejected by five scientific journals before they were successful in 2017 with the Proceedings of the National Academy of Sciences. The ominous emergence of new deadly coronaviruses did little to sway the field from downplaying their relevance.

“Everybody said, ‘Why are you working on coronaviruses? They just cause the common cold,’” Graham says. Yet he and McLellan persisted.

More evidence in this article of the vaxxine drill gone 'live' event in January 2020 with Graham and NIH and Moderna,
By the time the researchers showed success with the new technique in monkeys, the Zika epidemic had waned. But in 2017, having been impressed with mRNA, they worked with Moderna on a plan to combine the precision antigen design with the rapid and potent mRNA delivery. They focused on two virus families: coronaviruses (represented by MERS-CoV) and paramyxoviruses, for which Nipah virus—which had caused periodic outbreaks in Asia—was the prototype.

By early 2020, Graham’s group had designed the vaccine, and Moderna was ready to manufacture the Nipah mRNA and take it into a human clinical trial. But on Jan. 6, 2020, word came that Chinese scientists had isolated the virus that had caused an epidemic in Wuhan and was now in danger of creating a deadly worldwide pandemic.

“I called Jason and said, ‘Get back in the saddle,’” Graham remembers. “‘We’re going to have to solve another structure.’”

McLellan had the process down. On Jan. 10, Chinese scientists released the genetic sequence of the new virus, SARS-CoV-2. On the morning of Jan. 11, Graham’s lab and McLellan’s lab, now at University of Texas–Austin, worked together to design sequences to make the protein for solving structures, developing assays and immunizing mice.

This time, Graham vowed, they wouldn’t be late.

While McLellan was revealing the atomic structure of the new spike, Graham’s group provided the protein sequence for Moderna to begin manufacturing mRNA that could be injected into mice, as well as an assay to determine its effectiveness. Within two weeks, they started animal trials—an unheard-of speed for a newly discovered virus. But Graham was confident.
Now I have to ask (perhaps out of ignorance according to covidiot apologetics defenders out there, since they will say my credentials are not “expert' enough blah blah blah); how can you truly create a real “vaccine” and new recombinant virus proteins without even first obtaining and studying samples of the actual isolated and purified 'virus' stocks itself? Well, only from strictly just the Bio-informatics I presume.

So based upon the supposed mRNA sequence of the alleged 'SARS-CoV2' (at the time being called '2019-nCov') they can know the supposed amino acid chain sequence of the whole proteins, in this case the spike protein. The (probably AI driven) Bio-informatics can determine at least I guess theoretically the precise protein 3D folding and sub-unit structures of perhaps any given protein based on the full amino acid chain sequence. Not sure if this can take into account all the post processing/folding and other modifications from the cell protein producing organelles and whether or not a theoretical model of a Bio-informatics generated protein/structure (theoretical or a real known protein) truly matches the final output of the mRNA sequence transcribed into a poly peptide chain that eventually gets processed into a full protein. I don't doubt apologists for the 'covid' narrative will say it's all real “science' so it must be legit, quite obviously they will never question it one iota, even though it should be massively questioned if nothing but for the sake of so-called “science”.
Usually it takes anywhere from 18 months to three years to develop a vaccine that can be used in people. In this instance, it took just a few weeks.

“Within 41 days after we gave Moderna the protein sequence, they gave us back an mRNA product that could be put into people,” Graham says proudly. “We did animal and human studies in parallel, at the same time, so we would always have the data we needed to start the next stage.”

Now the state of the art of Bio-informatics available has definitely advanced since I was introduced to the very bare basics of it in 2002-2003 with my Bio-tech 11 month course; I don't doubt that in most cases the AI bio-informatic algorithms can precisely (relatively I'd say) characterize most proteins based on the genetic sequence alone (and translating to amino acid sequence etc.): perhaps it can even in the case of new designer genetic sequences not already existing in nature though? Or even a newly “discovered” (or 'discovered' in the case of 'covid' IMO) microbe?

That would be very interesting to know how well it would actually perform in the real world in a multitude of cases, but I digress... my main point is that if I am right when I say I believe it very possible that the published 'sars-cov2' genome is a fake theoretical fictitional genome (albeit likely mostly derived from multiple real viruses), than I bet very much that the AI-Bio-Informatics can produce the genetics and a protein (spike) that will suffice to use to deceive the rest of the world that 'sars-cov2' is a real virus. People will study the printed mRNA (and cDNA from that) and any produced proteins from cell cultures in the commercial kits, as it has been shown that the CDC (and likely everyone else too) has admitted using no 'sars-cov2' viral stock with which to do studies with.


Mark Denison's role in the developing 'covid' narrative,
It was the serum from those first eight subjects that Mark Denison’s lab analyzed two months later, delivering the good news to Graham that the vaccine was effective. “We were the very first humans to see the effect of this vaccine actually killing COVID,” Denison says. “It was a very emotional moment.”

Denison himself hadn’t been idle in tackling coronaviruses in the intervening years. Ever since the emergence of SARS in 2002, he had been warning about the possibility of a global coronavirus pandemic. “It’s like saying a Category 5 hurricane is going to hit New Orleans or Miami,” Denison says. “You know it’s going to happen, and you should be
prepared for it now.”

In recent years, Denison had been testing compounds to treat illnesses caused by coronaviruses. One promising treatment was called nucleoside analogues—compounds that mimic the genetic code of a virus, infiltrate it and kill it. Coronaviruses, however, have a unique ability to “proofread” their genes and remove nucleotides that don’t belong.

In 2014, Denison’s team tested a new compound by Gilead Sciences, now called remdesivir, and showed it was the first known drug to bypass coronavirus proofreading and thus stop the virus from replicating. Between 2014 and January 2020, the Denison lab team and their collaborators at University of North Carolina showed that remdesivir killed every known coronavirus, and it prevented and treated SARS and MERS in animals. This amazing timing led to clinical trials against COVID-19 in China and the United States by February 2020. By May, the Food and Drug Administration had issued an emergency authorization to use remdesivir to treat the virus in humans, followed by its licensure as the first COVID-19 antiviral.

With Graham’s invitation and support, Denison became involved in the design of clinical trials for the Moderna vaccine, and James Chappell led testing in the Denison lab of the phase 1 vaccine volunteers’ serum, from 1,000 patients across the country. Dr. Buddy Creech, BS’95, MPH’06, associate professor of pediatrics and director of the Vanderbilt Vaccine Research Program, directed phase 3 trials of the Moderna vaccine, and Kathryn Edwards, the founder and former longtime director of VVRP, served a critical role with data safety and monitoring boards at the national level for safety studies of the vaccine.

I will have to come back to the subject of Remdesivir, I have seen multiple comments online from Youtube to Facebook, Instagram and elsewhere that remdesivir is quite deadly (some claim up to 30% mortality in long enough term usage) and in general causes excess lung fluid buildup leading to pneumonia or increased and probably eventually to ARDS/death in many cases. Possibly like AZT was to HIV/AIDS, is remdesivir “covid” in a prescription? another drug that is basically causing the disease for which it is being masqueraded as one of the cures?

Other collaborators and colleagues (and alumni of Vanderbilt?) of Graham working on the 'covid' agenda,
Meanwhile, Graham’s former roommate Bill Gruber was testing Pfizer’s vaccine, also based on Graham’s techniques of stabilizing the spike protein, while James Crowe was pursuing a completely different tack to combat coronavirus with British pharmaceutical company AstraZeneca. Crowe had become fascinated with the phenomenon of monoclonal antibodies, which are custom-designed outside the body and then injected to attack a virus by inhibiting its ability to grow and reproduce. Theoretically, monoclonal antibodies can be used as a vaccine to create immunity and also as a treatment after a person is exposed or infected.

Last year, Crowe’s lab ran a simulation to show it could create monoclonal antibodies for a new virus in 78 days. When the COVID-19 coronavirus hit in early 2020, it cut that time by two-thirds, synthesizing antibodies in just 24 days. (The treatment is currently in phase 3 trials.) Crowe doesn’t think it’s an accident that the legacy of Vanderbilt’s unique vaccine program in the 1990s led to such quick responses—with vaccines, antivirals and antibodies—decades later.

“People say how could they make vaccines for corona so fast,” he says. “Well, they did it based on more than 30 years of research on RSV, HIV and MERS.”

If everything we are seeing about the vaxxines (the real vaxxes and not placebo/saline being the primary jabs given out) is true, certainly I believe portions of what I have seen is true, than these people need to be fully nominated for a Nuremburg style trial and execution:
Neuzil spent 2020 overseeing clinical trials, thinking the best-case scenario was to see vaccine approval by the end of the year. On Dec. 31, she got her first injection and sent a photo to Gruber and to Graham, who wrote back right away: “Seeing pictures of people being vaccinated is becoming one of my favorite pastimes.”

As pleased as Graham, who received the 2021 Vanderbilt Distinguished Alumnus Award, has been to see his labors bear fruit in potentially saving thousands—if not millions—of lives, he also sees the story of the coronavirus vaccine development as a cautionary tale.

“As bad as this is, we were lucky this was a coronavirus,” he says, noting that there are 26 families of viruses that infect humans, many of which are still mysterious to scientists. “If it was a bunyavirus or an arenavirus, we would have been lost for months or a year or two just trying to get the right thing made.”
Perhaps we should start looking at bunyavirus and arenavirus, whatever the hell they are, to predict a future coming plandemic scamdemic. Is it any of your business? Nunya bunya, motherf*cker:LOL::cautious:...


I saw some other papers of “coronavirus” research from the University of North Carolina at Chapel Hill with connections to Vanderbilt, and one in particular a Rachel L. Graham; who also participated in a study along with the famous (and infamous by now to many 'covid' skeptics) Chinese bat lady researcher Zheng-Li Shi.

Zheng-Li Shi is with the Wuhan Institute of Virology and worked on one of the studies implicated as an early or possible original 'isolation' of the 'sars-cov2' virus, I posted about that paper (A pneumonia outbreak associated with a new coronavirus of probable bat origin https://www.nature.com/articles/s41586-020-2012-7) in the Are the COVID-19 Test Kits Designed to Produce False Positives (Plandemic)? Thread.

Rachel L. Graham is an alumni of Vanderbilt University and studied under guess who, Mark Denison. I had thought that perhaps is Rachel a relative or even a daughter or niece of Barney Graham? I didn't find any family/relative connection on the generic People Finder site I used, however I find it very hard for me to believe that there is no connection (at the very least professional) at all between the two of them though.

Rachel Graham, PhD
Assistant Professor
Department of Epidemiology
https://sph.unc.edu/adv_profile/rachel-graham-phd/
from Vanderbilt University in 2006, from the laboratory of Mark Denison, MD, after which she came to the laboratory of Ralph Baric

Her training has focused on the molecular virology of coronaviruses, with a concentration on the mechanisms by which coronaviruses replicate, adapt to selective pressure, and emerge in novel host populations. Dr. Graham’s research emphases include coronavirus replication fidelity, viral genome recombination, candidate live-attenuated vaccine design and phylogenetic and molecular analyses of coronavirus genomes as they emerge and adapt to novel hosts. Dr. Graham began actively studying coronaviruses just prior to the SARS-CoV epidemic in 2003.

This paper here is where Rachel and Zheng-Li collaborated with the whole team, and with the creation of a chimeric genetically engineered virus that to me sounds a lot like “gain of function” viral research,

Published: 09 November 2015
A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence
Vineet D Menachery, Boyd L Yount Jr, Kari Debbink, Sudhakar Agnihothram, Lisa E Gralinski, Jessica A Plante, Rachel L Graham, Trevor Scobey, Xing-Yi Ge, Eric F Donaldson, Scott H Randell, Antonio Lanzavecchia, Wayne A Marasco, Zhengli-Li Shi & Ralph S Baric
https://www.nature.com/articles/nm.3985

goofy ass editor's note to attempt to 'debunk' conspiracy theories, pathetic, fucking please...
30 March 2020 Editors’ note, March 2020: We are aware that this article is being used as the basis for unverified theories that the novel coronavirus causing COVID-19 was engineered. There is no evidence that this is true; scientists believe that an animal is the most likely source of the coronavirus.

Abstract
The emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. Here we examine the disease potential of a SARS-like virus, SHC014-CoV, which is currently circulating in Chinese horseshoe bat populations1. Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild-type backbone can efficiently use multiple orthologs of the SARS receptor human angiotensin converting enzyme II (ACE2), replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from infection with CoVs using the novel spike protein. On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations.

Main
However, sequence data alone provides minimal insights to identify and prepare for future prepandemic viruses. Therefore, to examine the emergence potential (that is, the potential to infect humans) of circulating bat CoVs, we built a chimeric virus encoding a novel, zoonotic CoV spike protein—from the RsSHC014-CoV sequence that was isolated from Chinese horseshoe bats1—in the context of the SARS-CoV mouse-adapted backbone. The hybrid virus allowed us to evaluate the ability of the novel spike protein to cause disease independently of other necessary adaptive mutations in its natural backbone. Using this approach, we characterized CoV infection mediated by the SHC014 spike protein in primary human airway cells and in vivo, and tested the efficacy of available immune therapeutics against SHC014-CoV. Together, the strategy translates metagenomics data to help predict and prepare for future emergent viruses.
let me retype that for clarity, “Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone.


The results indicate that group 2b viruses encoding the SHC014 spike in a wild-type backbone can efficiently use multiple orthologs of the SARS receptor human angiotensin converting enzyme II (ACE2), replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV.

That doesn't sound like “gain of function” (in terms of receptor binding and replication in human cells et al) to you??!!

Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations.

You know this has 'covid' plandemic narrative written all over it...
During the SARS-CoV epidemic, links were quickly established between palm civets and the CoV strains that were detected in humans4. Building on this finding, the common emergence paradigm argues that epidemic SARS-CoV originated as a bat virus, jumped to civets and incorporated changes within the receptor-binding domain (RBD) to improve binding to civet Ace2 (ref. 18). Subsequent exposure to people in live-animal markets permitted human infection with the civet strain, which, in turn, adapted to become the epidemic strain (Fig. 4a). However, phylogenetic analysis suggests that early human SARS strains appear more closely related to bat strains than to civet strains18. Therefore, a second paradigm argues that direct bat-human transmission initiated SARS-CoV emergence and that palm civets served as a secondary host and reservoir for continued infection (Fig. 4b)19. For both paradigms, spike adaptation in a secondary host is seen as a necessity, with most mutations expected to occur within the RBD, thereby facilitating improved infection. Both theories imply that pools of bat CoVs are limited and that host-range mutations are both random and rare, reducing the likelihood of future emergence events in humans.
Clear foreshadowing of the future Wuhan wet market 'outbreak'? Come on now, spare me the coinkidink argument.

I really don't feel like it is necessary (nor time efficient) to go into any serious technical details here, the main point is this shows that with this line of “research' this group was developing and aiming it for, for exactly what the plandemic was rolled out to be, real or not, and mostly unreal even if I were to believe a virus was released or actually existed (artificially created or not). Even if there was a similar virus or viruses going around that the fake pcr tests are detecting, they are not new coronaviruses nor is there any valid proof IMSO whatsoever that they cause any so-called disease characterized (absurdly) as 'covid'. If they cause anything it is mild symptoms or the common cold to flu like illness, duh like so many other viruses, not that such illnesses can't kill people but only the serious health deficient vast majority of cases. Since there are so many of these viruses and so many we aren't even aware of or informed of, the bullshit 'pandemic' fighting measures are absurd and protect absolutely no one, cause more harm than they could protect at all, and are being used only for advancing the agenda(s) is all that can be said about them.


Further note of interest that the Journal corrected for this paper:

Change history​

  • 30 March 2020​

  • Editors’ note, March 2020:We are aware that this article is being used as the basis for unverified theories that the novel coronavirus causing COVID-19 was engineered. There is no evidence that this is true; scientists believe that an animal is the most likely source of the coronavirus.
    • 20 November 2015​


  • In the version of this article initially published online, the authors omitted to acknowledge a funding source, USAID-EPT-PREDICT funding from EcoHealth Alliance, to Z.-L.S. The error has been corrected for the print, PDF and HTML versions of this article.

I'm assuming this means the 2nd update that the omission of acknowledgment of the EcoHealth funding to Zheng-Li Shi was only corrected on 30th of March 2020 if I am interpreting that correctly.


Speaking of the EcoHealth Alliance, there is a Peter Daszak from the EcoHealth Alliance (based in NYC) that collaborated with Zheng-Li Shi on a paper in 2013; and EcoHealth was given NIH funding as was given to the Wuhan Institute of Virology beginning with Bush administration and continued with Obama and Trump, all overseen by Fauci and likely with Graham's input as well.

Published: 30 October 2013
Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor
Xing-Yi Ge, Jia-Lu Li, Xing-Lou Yang, Aleksei A. Chmura, Guangjian Zhu, Jonathan H. Epstein, Jonna K. Mazet, Ben Hu, Wei Zhang, Cheng Peng, Yu-Ji Zhang, Chu-Ming Luo, Bing Tan, Ning Wang, Yan Zhu, Gary Crameri, Shu-Yi Zhang, Lin-Fa Wang, Peter Daszak & Zheng-Li Shi
Nature volume 503, pages 535–538 (2013)
https://www.nature.com/articles/nature12711
Abstract
The 2002–3 pandemic caused by severe acute respiratory syndrome coronavirus (SARS-CoV) was one of the most significant public health events in recent history1. An ongoing outbreak of Middle East respiratory syndrome coronavirus2 suggests that this group of viruses remains a key threat and that their distribution is wider than previously recognized. Although bats have been suggested to be the natural reservoirs of both viruses3,4,5, attempts to isolate the progenitor virus of SARS-CoV from bats have been unsuccessful. Diverse SARS-like coronaviruses (SL-CoVs) have now been reported from bats in China, Europe and Africa5,6,7,8, but none is considered a direct progenitor of SARS-CoV because of their phylogenetic disparity from this virus and the inability of their spike proteins to use the SARS-CoV cellular receptor molecule, the human angiotensin converting enzyme II (ACE2)9,10. Here we report whole-genome sequences of two novel bat coronaviruses from Chinese horseshoe bats (family: Rhinolophidae) in Yunnan, China: RsSHC014 and Rs3367. These viruses are far more closely related to SARS-CoV than any previously identified bat coronaviruses, particularly in the receptor binding domain of the spike protein. Most importantly, we report the first recorded isolation of a live SL-CoV (bat SL-CoV-WIV1) from bat faecal samples in Vero E6 cells, which has typical coronavirus morphology, 99.9% sequence identity to Rs3367 and uses ACE2 from humans, civets and Chinese horseshoe bats for cell entry. Preliminary in vitro testing indicates that WIV1 also has a broad species tropism. Our results provide the strongest evidence to date that Chinese horseshoe bats are natural reservoirs of SARS-CoV, and that intermediate hosts may not be necessary for direct human infection by some bat SL-CoVs. They also highlight the importance of pathogen-discovery programs targeting high-risk wildlife groups in emerging disease hotspots as a strategy for pandemic preparedness.
Just more and more evidence of the 'covid' plandemic pre-planned foreshadowing...

Remember that one of the alleged bat CoVs claimed by this group from the A pneumonia outbreak associated with a new coronavirus paper (published February 2020), “(BatCoV RaTG13)—which was previously detected in Rhinolophus affinis from Yunnan province—showed high sequence identity to 2019-nCoV.”, and so these two bat CoVs RsSHC014 and Rs3367 were also from Yunnan province and all three from Rhinolophidae bats. RaTG13 is also the same virus (as admitted I believe by Zheng-Li Shi) as BtCoV/Ra4991 that was described in a 2016 paper (described with only one protein and no left over samples), and so Ra4991/RaTG13 being also 96% identical in sequence to the published genome of 'sars-cov2'.

Is it possible that 'sars-cov2' (published genome) is an amalgamation of multiple of these and other viruses? RsSHC014 and Rs3367 and Ra4991/RaTG13? What about the engineered chimeric virus from R.L. Graham and Zheng-Li in the A SARS-like cluster collaboration project (“Therefore, we synthesized the SHC014 spike in the context of the replication-competent, mouse-adapted SARS-CoV backbone (we hereafter refer to the chimeric CoV as SHC014-MA15)”), the SCH014 virus in that paper (2015) is also referred to RsSCH014 as it is referred to in the 2013 paper. It does not seem clear to me in the 2013 paper that RsSCH014 can use ACE2 (particularly human) receptor but the 2015 paper suggests it cannot. Bat SL-CoV-WIV1 mentioned in the 2013 paper as using (human and civets and bats) ACE2 which this virus is 99% identical to Rs3367 (might as well be the same thing).

Sounds reasonable to me that 'sars-cov2' genome is chimeric of all of these and other common human coronaviruses, but could it be proven with a genomic analysis? Perhaps even, is the chimeric CoV SHC014-MA15 simply 'sars-cov2'? What about the original published genome for it; oops, looks like it was not published until May of 2020,

Published: 22 May 2020
Author Correction: A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence
https://www.nature.com/articles/s41591-020-0924-2
Correction to: Nature Medicine https://doi.org/10.1038/nm.3985, published online 9 November 2015.

In the version of this article initially published, the sequence of the mouse adapted SHC015-MA15 virus had not been deposited in GenBank. The sequence has now been deposited in GenBank under accession number MT308984.

I have not looked yet, but doubtless this genome will not be identical to the 'sars-cov2' genome, of course that genome was 5 years late being published just like the Ra4991/RaTG13 (Jan. 27th 2020) was at least 4 or 7 years late being published, both only after 'sars-cov2' was published? What are the betting odds that the original genomes were exactly as published in 2020? We'll probably never know...

Trying to use the BLAST feature to compare the two sequences (MT308984 with one of the 'sars-cov2' published sequences MN908947.3) to see how similar they might be; ended up with this error message,
There was a problem with the search. Please, contact Help Desk and include RID TZZWSW20013.

CPU usage limit was exceeded. You may need to change your search strategy. Helpful changes include reducing the number of queries, choosing a smaller database and setting an organism limit. You may also need to adjust the Algorithm parameters in the bottom section of the form. Choose a smaller number of target sequences, set a smaller Expect cut-off, use a larger word-size and turn on species specific repeats.
Admittedly I am not really familiar enough or knowledgeable enough of this feature to use it proficiently, so I will try to see if I can narrow the range to just the spike protein sequence, maybe I can figure out how to set that BLAST up and see if it shows the comparison.

MT308984.1

21492..25262 = 3770 nucleotides
/codon_start=1
/product="SHC014 spike"

MN908947.3

21563..25384 = 3821 nucleotides, 51 nucleotides longer than SCH014 spike nucleotide sequence (it should be called SHC014-MA15 spike)
/gene="S"
/note="structural protein"
/codon_start=1
/product="surface glycoprotein"
/protein_id="QHD43416.1"
BLAST the two from 21492 to 25384, see if that nets anything lol.

Guess I figured something out, roughly ~75% sequence similarity I guess.

1637882211205.png

Alignments:
Mutant SARS coronavirus Urbani clone SARS-Urbani-MA_SHC014-spike, complete genome
Sequence ID: MT308984.1Length: 29730Number of Matches: 2
Range 1: 21720 to 25262GenBankGraphics Next Match Previous Match
Alignment statistics for match #1​

Score

Expect

Identities

Gaps

Strand

2360 bits(2617)

0.0

2697/3602(75%)

73/3602(2%)

Plus/Plus

Query 21797 TTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCT 21856
|||||||| || | |||| || | |||||| ||||||||||| | ||||| ||||||
Sbjct 21720 TTTGATAATCCCATAATACCCTTCAGGGATGGTATTTATTTTGCTGCGACTGAAAAGTCT 21779

Query 21857 AACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTT 21916
|| | || ||||| ||| |||||||| |||| | | || | || ||| | |
Sbjct 21780 AATGTTATTAGAGGATGGGTTTTTGGTTCTACAATGAACAACAAATCTCAATCCGTTATA 21839

Query 21917 ATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGAT 21976
|| | || ||| | |||||| | || |||| | ||| | ||| | || ||| | ||
Sbjct 21840 ATAATGAACAACTCAACTAATTTAGTCATTAGGGCTTGTAATTTTGAGTTGTGTGACAAT 21899

Query 21977 CCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGA 22036
|||||||| | ||| | ||| ||||| | | || | | | || |
Sbjct 21900 CCATTTTTTGTTGTGTTG------AAATCTAACAACACTCAAATACCATCTTA---CATA 21950

Query 22037 GTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGAC 22096
|| || | ||| |||||||| ||||||||||| ||| || |||| | |||
Sbjct 21951 TTTAAT---AATGCATTCAATTGCACATTTGAATATGTTTCTAAGGATTTTAACCTAGAC 22007

Query 22097 CTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGAT 22156
|||| | ||||| ||||||||||| |||| || || ||||| || | ||||| |||
Sbjct 22008 CTTGGTGAAAAACCAGGTAATTTCAAGGATCTCAGAGAGTTTGTTTTCAGGAATAAAGAT 22067

Query 22157 GGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGC--GTGATCTCCCTC 22214
|||| ||| | | ||||| || || ||| | | ||| ||| | | ||
Sbjct 22068 GGTTTTTTGCATGTTTATTCCGGTTACCAACCCATT--TCTGCTGCCAGTGGTTTGCCAA 22125

Query 22215 AGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGT 22274
|||||| || | |||| | | | || || | |||||||| || |||| |
Sbjct 22126 CTGGTTTTAATGCACTCAAACCTATTTTCAAGTTACCTCTGGGTATTAATATTACTAA-T 22184

Query 22275 TTCA-AACTTTACT---TGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA 22330
|||| ||| | || |||||| | || | ||| | ||| | | |||||
Sbjct 22185 TTCAGAACACTTCTGACTGCTTTTCCGCCTAG--ACCTGATTATTGGGG----TACTTCA 22238

Query 22331 GGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTA 22390
| |||||||||||| ||| || ||| | |||| | || || |
Sbjct 22239 G---------------CTGCAGCTTATTTTGTAGGATATTTAAAACCAACTACATTCATG 22283

Query 22391 TTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTC 22450
| || ||| |||||||||| || || ||||||||||| || ||| | | | || ||
Sbjct 22284 CTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTCGATTGTTCTCAAAATCCACTT 22343

Query 22451 TCAGAAACAAAGTGTAC-GTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTC 22509
| ||| || || | ||| ||| || | | || |||||||| |||||||| ||
Sbjct 22344 GCTGAACTCAAATGCTCTGTTAAAAGTTTTGAGATT-GACAAAGGAATTTATCAAACCTC 22402

Query 22510 TAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTG 22569
|| ||||| || ||| || | |||| || || ||||||||||||||| ||||
Sbjct 22403 CAATTTTAGGGTAGCACCCTCAAAGGAAGTTGTGAGGTTCCCTAATATTACAAACCTGTG 22462

Query 22570 CCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAA 22629
|||||||| || |||||||| || || | |||| | ||||| ||||| ||| | |||||
Sbjct 22463 TCCTTTTGGGGAGGTTTTTAATGCTACTACATTTCCTTCTGTCTATGCATGGGAGAGGAA 22522

Query 22630 GAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCAC 22689
||||| || |||||||||||||| ||||| || || || || |||| ||||| ||
Sbjct 22523 AAGAATTTCTAATTGTGTTGCTGATTACTCTGTACTCTACAACTCAACATCTTTTTCAAC 22582

Query 22690 TTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTA 22749
||||||||||||||| || ||| | ||||| | ||||| || ||||| | || |||||
Sbjct 22583 TTTTAAGTGTTATGGCGTTTCTGCCACTAAGCTGAATGACCTTTGCTTCTCCAACGTCTA 22642

Query 22750 TGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGG 22809
|||||||||||| ||| | | ||| ||||| || || ||||| || ||||| || || ||
Sbjct 22643 TGCAGATTCATTCGTAGTCAAAGGAGATGATGTAAGGCAAATAGCACCAGGACAGACCGG 22702

Query 22810 AAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTG 22869
||||||||||||||||| |||||||||||||| || || || || |||| ||
Sbjct 22703 TGTTATTGCTGATTATAATTACAAATTACCAGATGACTTCTTGGGTTGTGTCCTAGCATG 22762

Query 22870 GAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTT 22929
||| | || | |||||| | |||||||||||||| | ||||||| | |
Sbjct 22763 GAACACCAATTCTAAAGATTCTTCCACTTCCGGTAATTATAATTATTTATATAGATGGGT 22822

Query 22930 TAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTAT-CAGGCCG 22988
||| | |||||| || || |||| |||| | || | || | || |||||| || ||
Sbjct 22823 TAGAAGGTCTAAGCTTAACCCTTATGAGCGCGACTTATCTAACGACATCTATTCA--CCT 22880

Query 22989 GTAGCACAC-CTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATAT 23047
| || || |||| | ||| |||| ||||||||| || |||| |||||
Sbjct 22881 GGAGGTCAGTCTTGCTCAGCTGT---AGGTCCTAATTGTTATAACCCCTTACGTCCATAT 22937

Query 23048 GGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTT 23107
|| || | || ||||||||| ||||||| || ||||| |||||||||||||||
Sbjct 22938 GGCTTTTTTACAACAGCTGGTGTTGGACACCAACCTTATAGAGTTGTAGTACTTTCTTTT 22997

Query 23108 GAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAA 23167
|||||| || ||||||| || || || |||||||| ||| || || | | |||||
Sbjct 22998 GAACTTTTAAATGCACCCGCTACAGTCTGTGGACCAAAATTATCCACCGACCTTATTAAA 23057

Query 23168 AACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCT 23227
|| ||||||||||||| ||||| ||||| | || || || ||||| | ||| |||
Sbjct 23058 AATCAATGTGTCAATTTTAACTTTAATGGACTCACTGGTACTGGTGTGTTAACTCCTTCT 23117

Query 23228 AACAAAAAG-TTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGC 23286
|||| || |||| || || ||||||||||| | || || | || |||||| |
Sbjct 23118 T-CAAAGAGATTTCAACCATTTCAACAATTTGGTCGTGATGTTTCGGATTTCACTGATTC 23176

Query 23287 TGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGT 23346
|| || ||||| |||| ||| || | |||||| |||| || |||||||| |||||
Sbjct 23177 AGTTCGAGATCCGAAGACGTCTGAAATATTAGACATTTCACCTTGCTCTTTTGGCGGTGT 23236

Query 23347 CAGTGTTATAACACCAGGAACAAATACTTCTAACCAG--GTTGCTGTTCTTTATCAGGAT 23404
||||| || ||||| |||||||||||||| | ||| ||||||||||| ||||| |||
Sbjct 23237 AAGTGTAATCACACCTGGAACAAATACTTC--ATCAGAAGTTGCTGTTCTATATCAAGAT 23294

Query 23405 GTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGT 23464
||||||||||| || || ||||| || || |||||||| ||||| || ||| |||||||
Sbjct 23295 GTTAACTGCACTGATGTTCCTGTAGCAATCCATGCAGACCAACTCACACCTTCTTGGCGC 23354

Query 23465 GTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAA 23524
|| || ||||| || |||||| |||||||| | ||||||||| | ||||| |||||
Sbjct 23355 GTATACTCTACTGGAAATAATGTATTTCAAACCCAGGCAGGCTGTCTTATAGGAGCTGAG 23414

Query 23525 CATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTAT 23584
|||||| ||| || |||||||| ||||| || ||||| || || || || ||||||||
Sbjct 23415 CATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGAGCTGGCATTTGTGCTAGTTAC 23474

Query 23585 CAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTG-TAGCTAGTCAATCCATCATTGC 23643
|| || | | || || ||||||| |||| | |||| || | ||
Sbjct 23475 CATAC--------AGTTTCTTCATT----ACGTAGTACTAGCCAAA-AATCTATTGTGGC 23521

Query 23644 CTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCAT 23703
|| |||||||| | ||||| || | |||| ||||||||||||||||| | ||||| ||
Sbjct 23522 TTATACTATGTCTTTAGGTGCTGATAGTTCAATTGCTTACTCTAATAACACCATTGCTAT 23581

Query 23704 ACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGAC 23763
||| || || ||| | ||||| |||| |||||| | | || || |||||| | || ||
Sbjct 23582 ACCTACTAACTTTTCAATTAGCATTACTACAGAAGTAATGCCTGTTTCTATGGCTAAAAC 23641

Query 23764 ATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTT 23823
|| |||||||||| |||||||| || || ||||| |||||||| ||| | | |
Sbjct 23642 CTCTGTAGATTGTAATATGTACATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCT 23701

Query 23824 GCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACA 23883
|||||||| || ||||| |||||| |||| ||||| | | || || |||||||||||
Sbjct 23702 CCAATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGTTGAACA 23761

Query 23884 AGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAAT 23943
|| ||||| | ||||| || || |||||||||||||| |||||||| ||| | |
Sbjct 23762 GGATCGCAACACACGTGAAGTGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTT 23821

Query 23944 TAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAA 24003
|||||||||||||||||||||||||||||||||||||| || || ||| |||| ||
Sbjct 23822 GAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAAAGCCAACTAA 23881

Query 24004 GAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCAT 24063
|||||| |||||||| || | || || || || |||||||| || ||||||||||| ||
Sbjct 23882 GAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTTAT 23941

Query 24064 CAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAA 24123
|| |||||||| || ||||| ||||||||| ||||||||| ||||||||||| || ||
Sbjct 23942 GAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAA 24001

Query 24124 GTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACAC 24183
||| || || ||||| || |||||||| ||||||| ||||| ||||||||| |||||
Sbjct 24002 GTTCAATGGACTTACAGTGCTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACAC 24061

Query 24184 TTCTGCACT-GTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCAT 24242
| |||| || ||||| ||||| |||| |||| ||||| || ||||| || |||||
Sbjct 24062 TGCTGCTCTAGTTAG-TGGTACTGCCACTGCTGGATGGACATTCGGTGCTGGCGCTGCTC 24120

Query 24243 TACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGA 24302
| |||||||| ||||||||||||||||| |||||||| ||||| ||||||||||| || |
Sbjct 24121 TTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACTCAAA 24180

Query 24303 ATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAA 24362
||||||||||||||||||||||| || ||||| |||||||| | || || || |||
Sbjct 24181 ATGTTCTCTATGAGAACCAAAAACAAATCGCCAATCAATTTAACAAGGCGATCAGCCAAA 24240

Query 24363 TTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACC 24422
||||||| ||||| | | ||| | | |||| | || || || |||||||| |||||||
Sbjct 24241 TTCAAGAATCACTCACAACAACATCCACTGCATTGGGCAAGCTGCAAGATGTCGTCAACC 24300

Query 24423 AAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTT 24482
| ||||| ||||| |||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct 24301 AGAATGCTCAAGCATTAAACACACTTGTTAAACAACTTAGCTCCAATTTTGGTGCGATTT 24360

Query 24483 CAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTG 24542
||||||| |||||||||||||||| || ||||| ||||| ||||| || || |||||||
Sbjct 24361 CAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCAGAGGTACAAATTG 24420

Query 24543 ATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTA 24602
| ||||| || ||||||||||| ||||| | || || ||||| || |||||| |||| |
Sbjct 24421 ACAGGTTAATTACAGGCAGACTGCAAAGCCTTCAAACCTATGTAACACAACAACTAATCA 24480

Query 24603 GAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTAC 24662
| ||||| |||||||| |||||||||||||||||||||||||||||||| |||||||| |
Sbjct 24481 GGGCTGCTGAAATCAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTC 24540

Query 24663 TTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTC 24722
|||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |
Sbjct 24541 TTGGACAATCAAAAAGAGTTGACTTTTGCGGAAAGGGCTACCATCTTATGTCCTTCCCAC 24600

Query 24723 AGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGA 24782
| |||| || |||||||| |||||| | ||||| || ||||| || | ||||| | |
Sbjct 24601 AAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACATATGTGCCATCTCAAGAGAGAA 24660

Query 24783 ACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTG 24842
||||||| || || || || ||||||||||| || |||||| |||| |||||||||||||
Sbjct 24661 ACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTG 24720

Query 24843 TCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAA 24902
| ||||| | |||||||| |||||| | ||||| ||||| || | | |||||||
Sbjct 24721 TTTTTGTGTTTAATGGCACTTCGTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAA 24780

Query 24903 TCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCA 24962
| |||||||||||||| |||||||| || || | |||||||| ||||| || || | |
Sbjct 24781 TAATTACTACAGACAATACATTTGTCTCCGGAAGTTGTGATGTCGTAATTGGCATCATTA 24840

Query 24963 ACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATA 25022
|||||||||||||||||||| |||||||||| | ||||||||||| || ||| | || |
Sbjct 24841 ACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAGAAGAGCTGGACA 24900

Query 25023 AATATTTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATG 25082
| || || || ||||| |||||||||||||||||| | || ||||| || |||||||| |
Sbjct 24901 AGTACTTCAAAAATCACACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACG 24960

Query 25083 CTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAA 25142
|||| || || ||||||||||||||||||||||||||||||||||| || || |||||||
Sbjct 24961 CTTCTGTCGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAA 25020

Query 25143 ATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCAT 25202
||||||| ||||| || || |||||| | ||||| |||||||| ||||| |||||||| |
Sbjct 25021 ATGAATCACTCATTGACCTTCAAGAATTGGGAAAATATGAGCAATATATTAAATGGCCTT 25080

Query 25203 GGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGC 25262
|||| ||||||| || || || ||||| | |||||||| || ||||| ||||| |||
Sbjct 25081 GGTATGTTTGGCTCGGCTTCATTGCTGGACTAATTGCCATCGTCATGGTTACAATCTTGC 25140

Query 25263 TTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCT 25322
|||| || ||||| ||||| || ||||| |||||||| || |||||||| || ||||
Sbjct 25141 TTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCT 25200

Query 25323 GCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACAT 25382
|||| |||||||| || |||||||||||||| ||||| || |||||||||||||||||||
Sbjct 25201 GCAAGTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACAT 25260

Query 25383 AA 25384
||
Sbjct 25261 AA 25262

Range 2: 21597 to 21625GenBankGraphics Next Match Previous Match First Match
Alignment statistics for match #2​

Score

Expect

Identities

Gaps

Strand

30.1 bits(32)

0.012

26/30(87%)

2/30(6%)

Plus/Plus

Query 21653 TCTT-TCACACGTGGTGTTTATTACCCTGA 21681
|||| ||||| | |||||||||||||| ||
Sbjct 21597 TCTTCTCACA-GAGGTGTTTATTACCCAGA 21625

Not sure how much that means, or if there is any way to decipher if MN908947.3 was possibly derived (or partially) from MT308984.1 or could be related enough, from this comparison, I don't really know. 'sars-cov2' whole genome was about 70% the same as original sars-cov virus and supposedly related by alleged 20 years of evolution from bat to human to bat to civet or whatever, so 75% sounds relatively significant to me.

No way of knowing if this version of MT308984.1 genome is the original one they created or not is there? Perhaps the SCH014 spike genome could clue us in maybe but they made changes to it to facilitate it's ability to use ACE2 also in humans so it would surly be different than the chimeric SCH014-MA15 spike anyway. If they had simply removed about 51 nucleotides from the original SCH014-MA15 spike sequence created in 2015 to create the MT308984.1 sequence they published in May 2020, then the “Gaps” would only be 22/3602 about 0.61%: and just mess with the other 22 (or however many) left over nucleotides and get the result that we see; and then perhaps the 2697/3602 “Identities” sequence alignments would end up being much higher (than 75%), just a thought.
 
Last edited:

gl69m

Member
From the article in post #103,
(Shot in the Arm: Groundbreaking COVID-19 vaccine research by alumnus Dr. Barney Graham began at Vanderbilt decades ago

video of the the Vanderbilt team, partners in crime of a significant piece of the 'covid' (agenda, and) vaxxine agenda it would seem; the panel of them discuss the former research done there and how it relates to the 'covid-19' p(l)andemic,

Vanderbilt in the Vanguard: The Decades-long Journey to a Coronavirus Vaccine​

Unlisted

876 views
Mar 22, 2021

Wow, such monumental and now historical figures, that raced to create 'life' saving 'vaccines' to spare so many lives globally:rolleyes:, only 876 views, really!!??? You can just tell these people are super vaccine junkies, junkies for creating and selling (the need mostly) for vaccines (and now vaxxines), they seem to think that we need vac(x)ines now to save us from damn near every fucking microbe out there; well to clarify that Graham says that only 26 families of viruses infect humans, however many thousands (or magnitude order higher) of different kinds of viruses that is.

Denison and Graham both say things that should be very eye opening to the discerning dissenters looking for who to watch out for in predicting what (and possibly where from that) and who (involved in the current research) the next 'pandemic' will bring to the table:
Not sure of the time stamps here, but Denison uses the phrase (paraphrase) "that there are a myriad of "pandemic ready" obscure viruses already out there that we know can infect humans" (in cell cultures I think he means).
Graham uses the phrase "prototype pandemic preparedness", it would seem that's what he and his team at NIH and Moderna used to create their 6 week 'covid-19' spike-vax.
Neuzil keeps laughing repeatedly and inappropriately in my view when discussing all the "pandemic' talk.

I have to wonder why it is that people using any brains at all listening to this bullshit spiel that all these obscure viruses are gonna infect us all; should trust what these quacks are saying? That they are not highly paid off and deep involved in this 'covid' psyop. Why, why, why...
Imagine that, comments are turned off, huge surprise there haha...
 
Last edited:

Sinister Dick Cheney

Active member

Vaccine Bottles have Code #s for either Placebo, Vax, or Killshot​

Word is coming out of Slovenia that, if verified, will cause an unimaginable world reaction.


On Saturday 20 November, the Chief Nurse of the University Medical Center, Ljubljana Clinical Center, (pictured above, who deals with the administration of vaccine vials and manages everything, quit her job, went in front of TV cameras and took out vaccine bottles.

She showed the gathered journalists the codes on the bottles, each with the final number 1, 2, or 3 in the code, and then explained the meaning of these numbers:

Number 1 is placebo, saline.

Number 2 is the classic mRNA “vaccine”

Number 3 is an RNA stick containing the ONC gene, related to adenovirus, which contributes, among other things, to the development of cancer.

For these who get jabbed from vial whose code ends in the number 3, she says people who received them will have soft tissue cancer within 2 years.

She said that she had personally witnessed the vaccinations of all politicians and tycoons and that they all received the preparation number 1

The media has been told to absolutely bury this story and fierce efforts at containing this information are underway right now.
 
Top